Transcript: Mouse NM_053089.3

Mus musculus N(alpha)-acetyltransferase 15, NatA auxiliary subunit (Naa15), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Naa15 (74838)
Length:
6090
CDS:
308..2905

Additional Resources:

NCBI RefSeq record:
NM_053089.3
NBCI Gene record:
Naa15 (74838)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053089.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114622 GCCTATTACAAAGGCTTAGAA pLKO.1 1082 CDS 100% 5.625 7.875 N Naa15 n/a
2 TRCN0000114625 CCAACATTGATAGAACTCTTT pLKO.1 1520 CDS 100% 4.950 6.930 N Naa15 n/a
3 TRCN0000114621 GCCCTTCATTTCTAAGAATAT pLKO.1 3941 3UTR 100% 13.200 9.240 N Naa15 n/a
4 TRCN0000061332 CCAGTTTGACTTTCATACATA pLKO.1 1870 CDS 100% 5.625 3.938 N NAA15 n/a
5 TRCN0000300759 CCAGTTTGACTTTCATACATA pLKO_005 1870 CDS 100% 5.625 3.938 N NAA15 n/a
6 TRCN0000114624 CCCGAAACAGTTAGAACAGTA pLKO.1 2483 CDS 100% 4.950 3.465 N Naa15 n/a
7 TRCN0000114623 CCGAAACAGTTAGAACAGTAT pLKO.1 2484 CDS 100% 4.950 3.465 N Naa15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053089.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04179 pDONR223 100% 93% 98.3% None (many diffs) n/a
2 ccsbBroad304_04179 pLX_304 0% 93% 98.3% V5 (many diffs) n/a
3 TRCN0000492143 AACGGCCTTAATTATAAAACCACT pLX_317 15.1% 93% 98.3% V5 (many diffs) n/a
Download CSV