Transcript: Mouse NM_053105.2

Mus musculus kelch-like 1 (Klhl1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Klhl1 (93688)
Length:
4087
CDS:
718..2973

Additional Resources:

NCBI RefSeq record:
NM_053105.2
NBCI Gene record:
Klhl1 (93688)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053105.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072015 GCCCGAAAGAAGAACTTTAAT pLKO.1 2043 CDS 100% 15.000 12.000 N Klhl1 n/a
2 TRCN0000072013 TCTTTGCTACTGTGGTTATTT pLKO.1 3002 3UTR 100% 15.000 10.500 N Klhl1 n/a
3 TRCN0000417520 CCGCTTGGTTGTTCTCATAAT pLKO_005 3309 3UTR 100% 13.200 9.240 N Klhl1 n/a
4 TRCN0000413167 TTAGTTCAGGAATGGTTATTG pLKO_005 3188 3UTR 100% 13.200 9.240 N Klhl1 n/a
5 TRCN0000072017 CCTGATAGTTGGAAATCGAAA pLKO.1 1371 CDS 100% 4.950 3.465 N Klhl1 n/a
6 TRCN0000072016 CCTGTCTGAGTTCAATGGAAT pLKO.1 2561 CDS 100% 4.950 3.465 N Klhl1 n/a
7 TRCN0000072014 CCTTTGAGTATGCCTAGAGAT pLKO.1 2779 CDS 100% 4.950 3.465 N Klhl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053105.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08750 pDONR223 100% 89% 95% None (many diffs) n/a
2 ccsbBroad304_08750 pLX_304 0% 89% 95% V5 (many diffs) n/a
3 TRCN0000469355 GGTCAGGACTTCCGGCACCAGCCA pLX_317 17.2% 89% 95% V5 (many diffs) n/a
Download CSV