Transcript: Mouse NM_053207.2

Mus musculus egl-9 family hypoxia-inducible factor 1 (Egln1), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Egln1 (112405)
Length:
3524
CDS:
201..1403

Additional Resources:

NCBI RefSeq record:
NM_053207.2
NBCI Gene record:
Egln1 (112405)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009743 GCGAGCGAGAGCTAAAGTAAA pLKO.1 1316 CDS 100% 13.200 18.480 N Egln1 n/a
2 TRCN0000280120 GCGAGCGAGAGCTAAAGTAAA pLKO_005 1316 CDS 100% 13.200 18.480 N Egln1 n/a
3 TRCN0000009740 CGTCACGTTGATAACCCAAAT pLKO.1 1065 CDS 100% 10.800 15.120 N Egln1 n/a
4 TRCN0000280177 CGTCACGTTGATAACCCAAAT pLKO_005 1065 CDS 100% 10.800 15.120 N Egln1 n/a
5 TRCN0000009742 CGCAATAACTGTTTGGTATTT pLKO.1 1283 CDS 100% 13.200 10.560 N Egln1 n/a
6 TRCN0000297771 CGCAATAACTGTTTGGTATTT pLKO_005 1283 CDS 100% 13.200 10.560 N Egln1 n/a
7 TRCN0000009741 GCCAAGGTAAGTGGAGGTATT pLKO.1 1137 CDS 100% 10.800 7.560 N Egln1 n/a
8 TRCN0000297772 GCCAAGGTAAGTGGAGGTATT pLKO_005 1137 CDS 100% 10.800 7.560 N Egln1 n/a
9 TRCN0000009739 GCACTCAACTAACTCAACATA pLKO.1 2079 3UTR 100% 5.625 3.938 N Egln1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12062 pDONR223 100% 28.9% 30.5% None (many diffs) n/a
2 TRCN0000473834 GCAACGTATCGCATTATTCTCGAC pLX_317 100% 28.9% 30.5% V5 (many diffs) n/a
Download CSV