Transcript: Mouse NM_053225.1

Mus musculus vomeronasal 1 receptor 50 (Vmn1r50), mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Mus musculus (mouse)
Gene:
Vmn1r50 (113852)
Length:
933
CDS:
1..933

Additional Resources:

NCBI RefSeq record:
NM_053225.1
NBCI Gene record:
Vmn1r50 (113852)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053225.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075670 CTGTGAGTTACTCTAGAACAA pLKO.1 527 CDS 100% 4.950 6.930 N Vmn1r50 n/a
2 TRCN0000075668 CTTCAATTCAACCTCAGATAA pLKO.1 471 CDS 100% 13.200 9.240 N Vmn1r50 n/a
3 TRCN0000075669 GTTCAATTCTACCTGTGAGTT pLKO.1 515 CDS 100% 4.950 3.465 N Vmn1r50 n/a
4 TRCN0000075672 ACTTTCCACAATGATGACCAT pLKO.1 552 CDS 100% 2.640 1.848 N Vmn1r50 n/a
5 TRCN0000075671 CCTTCATGAGAACAAGCCCAA pLKO.1 117 CDS 100% 2.160 1.296 N Vmn1r50 n/a
6 TRCN0000328196 CCCAACTAATGCTGCTTATAA pLKO_005 173 CDS 100% 15.000 7.500 Y Vmn1r53 n/a
7 TRCN0000339957 ATGCCAATCCCTTATCTATTT pLKO_005 252 CDS 100% 13.200 6.600 Y Vmn1r44 n/a
8 TRCN0000339959 CATAGCTGTGGACATGTTTAT pLKO_005 204 CDS 100% 13.200 6.600 Y Vmn1r44 n/a
9 TRCN0000328199 CATGCCAATCCCTTATCTATT pLKO_005 251 CDS 100% 13.200 6.600 Y Vmn1r53 n/a
10 TRCN0000328136 TCATAGCTGTGGACATGTTTA pLKO_005 203 CDS 100% 13.200 6.600 Y Vmn1r53 n/a
11 TRCN0000075682 CCCTTATCTATTTGCACAGGT pLKO.1 260 CDS 100% 2.640 1.320 Y Vmn1r44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053225.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.