Transcript: Mouse NM_053242.4

Mus musculus forkhead box P2 (Foxp2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Foxp2 (114142)
Length:
6760
CDS:
660..2804

Additional Resources:

NCBI RefSeq record:
NM_053242.4
NBCI Gene record:
Foxp2 (114142)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053242.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071997 GCGACATTCAGACAAATACAA pLKO.1 2087 CDS 100% 5.625 7.875 N Foxp2 n/a
2 TRCN0000426178 CCATCTCCCAAACCTCTAAAT pLKO_005 1908 CDS 100% 13.200 9.240 N FOXP2 n/a
3 TRCN0000071996 GCAACAGTTCAATGAATCAAA pLKO.1 691 CDS 100% 5.625 3.938 N Foxp2 n/a
4 TRCN0000071994 CGGACAGTCTTCAGTTCTGAA pLKO.1 1610 CDS 100% 4.950 3.465 N Foxp2 n/a
5 TRCN0000071995 CCACACATACATTCAATCCAT pLKO.1 2652 CDS 100% 3.000 2.100 N Foxp2 n/a
6 TRCN0000071993 CGGAAGTTATTGATGTGGTAT pLKO.1 5042 3UTR 100% 4.950 2.970 N Foxp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053242.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13001 pDONR223 100% 80.8% 86.7% None (many diffs) n/a
2 ccsbBroad304_13001 pLX_304 0% 80.8% 86.7% V5 (many diffs) n/a
3 TRCN0000479678 TTAGAAATTCCACCGCAATTTGCA pLX_317 18.3% 80.8% 86.7% V5 (many diffs) n/a
Download CSV