Transcript: Mouse NM_053255.3

Mus musculus elaC ribonuclease Z 1 (Elac1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Elac1 (114615)
Length:
4971
CDS:
87..1175

Additional Resources:

NCBI RefSeq record:
NM_053255.3
NBCI Gene record:
Elac1 (114615)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053255.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249001 TGCGTTAGTCCTGCGTAATAA pLKO_005 1900 3UTR 100% 15.000 21.000 N Elac1 n/a
2 TRCN0000249003 TCGGCATTCCGATCAAGAAAT pLKO_005 1153 CDS 100% 13.200 18.480 N Elac1 n/a
3 TRCN0000248999 TTGGATAATGGAGTTACAATT pLKO_005 762 CDS 100% 13.200 9.240 N Elac1 n/a
4 TRCN0000249002 ACTTCAGTCAGAGGTACAAAC pLKO_005 1021 CDS 100% 10.800 7.560 N Elac1 n/a
5 TRCN0000249000 ATGATTCCCAGATGGACAAAG pLKO_005 919 CDS 100% 10.800 7.560 N Elac1 n/a
6 TRCN0000193307 CTTAGCACTTTGTTCAACATT pLKO.1 1727 3UTR 100% 5.625 3.938 N Elac1 n/a
7 TRCN0000175691 GAGCAGAATTTGCATAGAGTT pLKO.1 1600 3UTR 100% 4.950 3.465 N Elac1 n/a
8 TRCN0000051827 GAAGTGACTCTAGCAGAAGAT pLKO.1 1122 CDS 100% 4.950 2.970 N ELAC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053255.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08540 pDONR223 100% 86.4% 91.4% None (many diffs) n/a
2 ccsbBroad304_08540 pLX_304 0% 86.4% 91.4% V5 (many diffs) n/a
3 TRCN0000465934 AGGGATCCAAATCCGCCCCGTTAC pLX_317 38.8% 86.4% 91.4% V5 (many diffs) n/a
Download CSV