Transcript: Mouse NM_054041.2

Mus musculus anthrax toxin receptor 1 (Antxr1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Antxr1 (69538)
Length:
5280
CDS:
334..2022

Additional Resources:

NCBI RefSeq record:
NM_054041.2
NBCI Gene record:
Antxr1 (69538)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_054041.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336489 ATGACTCAGTCACGCTCAATG pLKO_005 1112 CDS 100% 10.800 15.120 N Antxr1 n/a
2 TRCN0000175319 CGATGATGGTTTGCCAAAGAA pLKO.1 1425 CDS 100% 5.625 7.875 N Antxr1 n/a
3 TRCN0000174699 GCTACCATAAAGAAGTGGAAA pLKO.1 4745 3UTR 100% 4.950 3.960 N Antxr1 n/a
4 TRCN0000328858 ACAGTAGATGCCTCTTATTAT pLKO_005 1456 CDS 100% 15.000 10.500 N Antxr1 n/a
5 TRCN0000336488 CCTGATGTTTGCACGATTTAA pLKO_005 2117 3UTR 100% 15.000 10.500 N Antxr1 n/a
6 TRCN0000328859 AGAAATCCTGCATCGAAATTC pLKO_005 977 CDS 100% 13.200 9.240 N Antxr1 n/a
7 TRCN0000176331 CCACAGTAGATGCCTCTTATT pLKO.1 1454 CDS 100% 13.200 9.240 N Antxr1 n/a
8 TRCN0000063221 GCTGCACCACTGGAATGAAAT pLKO.1 492 CDS 100% 13.200 9.240 N ANTXR1 n/a
9 TRCN0000336487 ACAGTAAGGACCACGTGTTTC pLKO_005 905 CDS 100% 10.800 7.560 N Antxr1 n/a
10 TRCN0000215686 GACAACTTTAATGAAACTAAC pLKO.1 594 CDS 100% 10.800 7.560 N Antxr1 n/a
11 TRCN0000194097 GCCAGTGAGCAGATTTACTAT pLKO.1 706 CDS 100% 5.625 3.938 N Antxr1 n/a
12 TRCN0000175018 GCTCACAAGTATTACCAGTTA pLKO.1 2965 3UTR 100% 4.950 3.465 N Antxr1 n/a
13 TRCN0000193995 GTTGGCGTGAAGGATTTCAAT pLKO.1 859 CDS 100% 5.625 3.375 N Antxr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_054041.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04338 pDONR223 100% 50.1% 53.2% None (many diffs) n/a
2 ccsbBroad304_04338 pLX_304 0% 50.1% 53.2% V5 (many diffs) n/a
3 TRCN0000475197 CTAAAAGTAAAAATAGTAAACTGC pLX_317 57.5% 50.1% 53.2% V5 (many diffs) n/a
Download CSV