Transcript: Mouse NM_054044.2

Mus musculus adhesion G protein-coupled receptor A2 (Adgra2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Adgra2 (78560)
Length:
5520
CDS:
106..4116

Additional Resources:

NCBI RefSeq record:
NM_054044.2
NBCI Gene record:
Adgra2 (78560)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_054044.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012028 GCCATGCTAATAATCTGACTT pLKO.1 4979 3UTR 100% 4.950 6.930 N Adgra2 n/a
2 TRCN0000350174 GCCATGCTAATAATCTGACTT pLKO_005 4979 3UTR 100% 4.950 6.930 N Adgra2 n/a
3 TRCN0000012032 CCCTAGACTTCTCAGACTAAA pLKO.1 570 CDS 100% 13.200 9.240 N Adgra2 n/a
4 TRCN0000314231 CCCTAGACTTCTCAGACTAAA pLKO_005 570 CDS 100% 13.200 9.240 N Adgra2 n/a
5 TRCN0000012031 GCTGAACCTTTGTTTCCATAT pLKO.1 2523 CDS 100% 10.800 7.560 N Adgra2 n/a
6 TRCN0000314172 GCTGAACCTTTGTTTCCATAT pLKO_005 2523 CDS 100% 10.800 7.560 N Adgra2 n/a
7 TRCN0000012029 CGCTCAACACTACCAGTCTTA pLKO.1 3986 CDS 100% 4.950 3.465 N Adgra2 n/a
8 TRCN0000350114 CGCTCAACACTACCAGTCTTA pLKO_005 3986 CDS 100% 4.950 3.465 N Adgra2 n/a
9 TRCN0000012030 GCCTATCACCTGGATCTACTT pLKO.1 2907 CDS 100% 4.950 3.465 N Adgra2 n/a
10 TRCN0000314233 GCCTATCACCTGGATCTACTT pLKO_005 2907 CDS 100% 4.950 3.465 N Adgra2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_054044.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492170 GAGTTACTAGGCCCCGACTTGTTA pLX_317 12.3% 70.6% 73.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV