Transcript: Human NM_057175.5

Homo sapiens N(alpha)-acetyltransferase 15, NatA auxiliary subunit (NAA15), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
NAA15 (80155)
Length:
6174
CDS:
274..2874

Additional Resources:

NCBI RefSeq record:
NM_057175.5
NBCI Gene record:
NAA15 (80155)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_057175.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304198 AGCACTCAAGCCAGCTAATAT pLKO_005 1071 CDS 100% 15.000 21.000 N NAA15 n/a
2 TRCN0000304200 GCTAAAGAAGCTACGTAATAA pLKO_005 2046 CDS 100% 15.000 10.500 N NAA15 n/a
3 TRCN0000304136 TTGGACCATATCTAGTATATA pLKO_005 2904 3UTR 100% 15.000 10.500 N NAA15 n/a
4 TRCN0000061331 GCCATTAAGTGTTACAGAAAT pLKO.1 568 CDS 100% 13.200 9.240 N NAA15 n/a
5 TRCN0000300833 GCCATTAAGTGTTACAGAAAT pLKO_005 568 CDS 100% 13.200 9.240 N NAA15 n/a
6 TRCN0000061332 CCAGTTTGACTTTCATACATA pLKO.1 1836 CDS 100% 5.625 3.938 N NAA15 n/a
7 TRCN0000300759 CCAGTTTGACTTTCATACATA pLKO_005 1836 CDS 100% 5.625 3.938 N NAA15 n/a
8 TRCN0000061328 CGGTAGAGAATTTGAATGAAA pLKO.1 1697 CDS 100% 5.625 3.938 N NAA15 n/a
9 TRCN0000061330 GCAATCATAGAAGAGTTAGTA pLKO.1 1291 CDS 100% 5.625 3.938 N NAA15 n/a
10 TRCN0000061329 CCTATTACAAAGGCTTGGAAA pLKO.1 1049 CDS 100% 4.950 3.465 N NAA15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_057175.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04179 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04179 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000492143 AACGGCCTTAATTATAAAACCACT pLX_317 15.1% 100% 100% V5 n/a
Download CSV