Transcript: Mouse NM_078478.5

Mus musculus growth hormone inducible transmembrane protein (Ghitm), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ghitm (66092)
Length:
2906
CDS:
168..1208

Additional Resources:

NCBI RefSeq record:
NM_078478.5
NBCI Gene record:
Ghitm (66092)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_078478.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193566 GTAATCAAACGTGCAGAAATA pLKO.1 1062 CDS 100% 13.200 18.480 N Ghitm n/a
2 TRCN0000340597 GTAATCAAACGTGCAGAAATA pLKO_005 1062 CDS 100% 13.200 18.480 N Ghitm n/a
3 TRCN0000193107 CCCATCAATTCGATGTTGACA pLKO.1 1113 CDS 100% 3.000 4.200 N Ghitm n/a
4 TRCN0000340679 ACAATCTACATGGATACATTA pLKO_005 1131 CDS 100% 13.200 9.240 N Ghitm n/a
5 TRCN0000175347 CAAAGAACCAATGGCTCGTAA pLKO.1 268 CDS 100% 4.950 3.465 N Ghitm n/a
6 TRCN0000340596 CAAAGAACCAATGGCTCGTAA pLKO_005 268 CDS 100% 4.950 3.465 N Ghitm n/a
7 TRCN0000193694 CCAGTGAAAGACATCAGAGAT pLKO.1 1659 3UTR 100% 4.950 3.465 N Ghitm n/a
8 TRCN0000174896 GCTTGTTTAATAGGAGCAGAT pLKO.1 1246 3UTR 100% 4.050 2.835 N Ghitm n/a
9 TRCN0000340598 GCTTGTTTAATAGGAGCAGAT pLKO_005 1246 3UTR 100% 4.050 2.835 N Ghitm n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_078478.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02988 pDONR223 100% 90.4% 91.6% None (many diffs) n/a
2 ccsbBroad304_02988 pLX_304 0% 90.4% 91.6% V5 (many diffs) n/a
3 TRCN0000491911 TTTATGATCCAAGCAGGATTTTTA pLX_317 20.6% 90.4% 91.6% V5 (many diffs) n/a
Download CSV