Transcript: Mouse NM_080436.3

Mus musculus retinol dehydrogenase 1 (all trans) (Rdh1), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Rdh1 (107605)
Length:
3890
CDS:
176..1129

Additional Resources:

NCBI RefSeq record:
NM_080436.3
NBCI Gene record:
Rdh1 (107605)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041999 CATGGGCCGAATGTCTTTCTT pLKO.1 670 CDS 100% 5.625 4.500 N Rdh1 n/a
2 TRCN0000041998 GCTTCAAGACTTGTGTGACAA pLKO.1 798 CDS 100% 4.950 3.465 N Rdh1 n/a
3 TRCN0000042000 CAAAGAGATCTATGGCGAGAA pLKO.1 877 CDS 100% 4.050 2.835 N Rdh1 n/a
4 TRCN0000042001 CAAGTAGTGACAGGCTATCAT pLKO.1 816 CDS 100% 5.625 3.375 N Rdh1 n/a
5 TRCN0000445030 GGGTGAAGGTGGCTATTATAG pLKO_005 768 CDS 100% 13.200 6.600 Y Rdh16 n/a
6 TRCN0000190157 GCTGAGGAACAAGACATCTGA pLKO.1 379 CDS 100% 3.000 1.500 Y Rdh18-ps n/a
7 TRCN0000041977 CGAATTGGACAAGAGGTGCAA pLKO.1 928 CDS 100% 2.640 1.320 Y Rdh9 n/a
8 TRCN0000202357 GAACAAGACATCTGACAGGCT pLKO.1 385 CDS 100% 0.660 0.330 Y Rdh18-ps n/a
9 TRCN0000041439 CCAAGACAAGTATGTCTTCAT pLKO.1 256 CDS 100% 0.495 0.248 Y Rdh19 n/a
10 TRCN0000115531 CCTCCCATTGATGACCAACTA pLKO.1 2917 3UTR 100% 4.950 2.475 Y Ermap n/a
11 TRCN0000041947 GTGAGCCATCTCCAAGACAAA pLKO.1 245 CDS 100% 4.950 2.475 Y Rdh16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.