Transcript: Mouse NM_080456.1

Mus musculus mitochondrial ribosomal protein S6 (Mrps6), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Mrps6 (121022)
Length:
795
CDS:
101..478

Additional Resources:

NCBI RefSeq record:
NM_080456.1
NBCI Gene record:
Mrps6 (121022)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_080456.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190500 GCCATAGTGAGGAACTTGGAA pLKO.1 200 CDS 100% 3.000 2.400 N Mrps6 n/a
2 TRCN0000217774 CACCAGATTCTGGCCTTATAT pLKO.1 486 3UTR 100% 15.000 10.500 N Mrps6 n/a
3 TRCN0000249490 TGACGTGGTTAGACCAAATAT pLKO_005 358 CDS 100% 15.000 10.500 N Mrps6 n/a
4 TRCN0000249488 GCTGCTTTGAAACGTACAATA pLKO_005 158 CDS 100% 13.200 9.240 N Mrps6 n/a
5 TRCN0000249489 GTTGTTGTCTAGGATACTTTA pLKO_005 538 3UTR 100% 13.200 9.240 N Mrps6 n/a
6 TRCN0000249487 AGGGTATTTCCTGGTGGATTT pLKO_005 283 CDS 100% 10.800 7.560 N Mrps6 n/a
7 TRCN0000192462 CTGCTGCTTTGAAACGTACAA pLKO.1 156 CDS 100% 4.950 3.465 N Mrps6 n/a
8 TRCN0000192555 GAGAACATACTGGAACACTTG pLKO.1 326 CDS 100% 4.050 2.835 N Mrps6 n/a
9 TRCN0000257886 CAAGTGCTGTGGAGAACATAC pLKO_005 315 CDS 100% 10.800 6.480 N Mrps6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080456.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08883 pDONR223 100% 83.7% 85.6% None (many diffs) n/a
2 ccsbBroad304_08883 pLX_304 0% 83.7% 85.6% V5 (many diffs) n/a
3 TRCN0000466813 CATTGACTTTCGGTTTTATATCCT pLX_317 100% 83.7% 85.6% V5 (many diffs) n/a
Download CSV