Transcript: Human NM_080600.2

Homo sapiens myelin associated glycoprotein (MAG), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
MAG (4099)
Length:
2503
CDS:
199..1947

Additional Resources:

NCBI RefSeq record:
NM_080600.2
NBCI Gene record:
MAG (4099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080600.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244102 TTGCCATCGTCTGCTACATTA pLKO_005 1778 CDS 100% 13.200 18.480 N MAG n/a
2 TRCN0000244103 ATGGTGTCTGGTACTTCAATA pLKO_005 365 CDS 100% 13.200 9.240 N MAG n/a
3 TRCN0000179256 GCTAGCTGAGTATGCTGAAAT pLKO.1 2091 3UTR 100% 13.200 9.240 N MAG n/a
4 TRCN0000244101 GCTAGCTGAGTATGCTGAAAT pLKO_005 2091 3UTR 100% 13.200 9.240 N MAG n/a
5 TRCN0000244104 CCAACAGTGAACGGGACAATG pLKO_005 1183 CDS 100% 10.800 7.560 N MAG n/a
6 TRCN0000244100 GTGTGGCTGAGAACCAGTATG pLKO_005 1373 CDS 100% 10.800 7.560 N MAG n/a
7 TRCN0000183999 CTTCAACCTGTCTGTGGAGTT pLKO.1 1410 CDS 100% 4.050 2.835 N MAG n/a
8 TRCN0000196036 GAGCTAGCTGAGTATGCTGAA pLKO.1 2089 3UTR 100% 4.050 2.835 N MAG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080600.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06550 pDONR223 100% 91.8% 91.6% None (many diffs) n/a
2 ccsbBroad304_06550 pLX_304 0% 91.8% 91.6% V5 (many diffs) n/a
3 TRCN0000478714 GTAAAGATAGCATCACTTCAATGT pLX_317 20.1% 91.8% 91.6% V5 (many diffs) n/a
Download CSV