Transcript: Human NM_080656.3

Homo sapiens CDKN2A interacting protein N-terminal like (CDKN2AIPNL), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CDKN2AIPNL (91368)
Length:
1228
CDS:
28..378

Additional Resources:

NCBI RefSeq record:
NM_080656.3
NBCI Gene record:
CDKN2AIPNL (91368)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080656.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423549 GAAGCACAAAGGTGCAGTATT pLKO_005 705 3UTR 100% 13.200 10.560 N CDKN2AIPNL n/a
2 TRCN0000178895 CCCAGGAGTTATCACTGTAAA pLKO.1 551 3UTR 100% 13.200 9.240 N CDKN2AIPNL n/a
3 TRCN0000179873 CCTAGGCTGCAGTTACAATAA pLKO.1 255 CDS 100% 13.200 9.240 N CDKN2AIPNL n/a
4 TRCN0000183155 GCCAGAAGATTTATCACATTT pLKO.1 379 CDS 100% 13.200 9.240 N CDKN2AIPNL n/a
5 TRCN0000427145 AGAAGGACTCTGTCTAGATTG pLKO_005 508 3UTR 100% 10.800 7.560 N CDKN2AIPNL n/a
6 TRCN0000183001 CTACCAGAAGTGAATTAATGA pLKO.1 341 CDS 100% 5.625 3.938 N CDKN2AIPNL n/a
7 TRCN0000150282 CCATAATAATCCCAGCACTTT pLKO.1 913 3UTR 100% 4.950 3.465 N CDKN2AIPNL n/a
8 TRCN0000183382 GCAGTTACAATAAAGACCTTT pLKO.1 263 CDS 100% 4.950 3.465 N CDKN2AIPNL n/a
9 TRCN0000150025 CACAATTTACTACCAGAAGTG pLKO.1 332 CDS 100% 4.050 2.835 N CDKN2AIPNL n/a
10 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 794 3UTR 100% 0.495 0.248 Y C11orf44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080656.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04540 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04540 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468948 GAACAATTCTCCAATCTTCAAACA pLX_317 100% 100% 100% V5 n/a
4 ccsbBroadEn_16062 pDONR223 0% 71.9% 68.9% None (many diffs) n/a
5 ccsbBroad304_16062 pLX_304 0% 71.9% 68.9% V5 (many diffs) n/a
6 TRCN0000466020 ACTGTCAGATTCACTGTCAACTTC pLX_317 100% 71.9% 68.9% V5 (many diffs) n/a
Download CSV