Transcript: Human NM_080742.3

Homo sapiens beta-1,3-glucuronyltransferase 2 (B3GAT2), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
B3GAT2 (135152)
Length:
6587
CDS:
632..1603

Additional Resources:

NCBI RefSeq record:
NM_080742.3
NBCI Gene record:
B3GAT2 (135152)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080742.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035657 CTATGCCATCACGCCCACCTA pLKO.1 877 CDS 100% 0.880 1.232 N B3GAT2 n/a
2 TRCN0000422942 GGATGCAAGAATCTGACTTTC pLKO_005 1440 CDS 100% 10.800 7.560 N B3GAT2 n/a
3 TRCN0000438063 GTCCAGCCAGTGGATCCATAT pLKO_005 1629 3UTR 100% 10.800 7.560 N B3GAT2 n/a
4 TRCN0000035658 ACATGGCAGGATTTGCTGTAA pLKO.1 1359 CDS 100% 4.950 3.465 N B3GAT2 n/a
5 TRCN0000035655 CTGGATCCTAATTGTCATCAT pLKO.1 673 CDS 100% 4.950 3.465 N B3GAT2 n/a
6 TRCN0000035656 GCAAAGTTGTTGGCTGGTACA pLKO.1 1305 CDS 100% 4.050 2.835 N B3GAT2 n/a
7 TRCN0000035654 GCCATCGACATGGCAGGATTT pLKO.1 1352 CDS 100% 1.080 0.756 N B3GAT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080742.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13183 pDONR223 100% 77.7% 77.3% None 374_589del n/a
2 ccsbBroad304_13183 pLX_304 0% 77.7% 77.3% V5 374_589del n/a
3 TRCN0000469765 CCTCCGTGTCCGCAAAACTAATGT pLX_317 64.4% 77.7% 77.3% V5 374_589del n/a
Download CSV