Transcript: Human NM_080821.3

Homo sapiens family with sequence similarity 210 member B (FAM210B), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
FAM210B (116151)
Length:
2987
CDS:
33..611

Additional Resources:

NCBI RefSeq record:
NM_080821.3
NBCI Gene record:
FAM210B (116151)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080821.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147191 CTCATTAATTTCCTTGGGCAT pLKO.1 353 CDS 100% 2.160 1.728 N FAM210B n/a
2 TRCN0000319304 CTCATTAATTTCCTTGGGCAT pLKO_005 353 CDS 100% 2.160 1.728 N FAM210B n/a
3 TRCN0000147018 CTGCTGAAACTCGGATTTAAA pLKO.1 417 CDS 100% 15.000 10.500 N FAM210B n/a
4 TRCN0000319297 CTGCTGAAACTCGGATTTAAA pLKO_005 417 CDS 100% 15.000 10.500 N FAM210B n/a
5 TRCN0000148123 GCCCTTGATTGTCAGATATTT pLKO.1 548 CDS 100% 15.000 10.500 N FAM210B n/a
6 TRCN0000319298 GCCCTTGATTGTCAGATATTT pLKO_005 548 CDS 100% 15.000 10.500 N FAM210B n/a
7 TRCN0000148303 CATTGCACATTGGAATCTCAT pLKO.1 337 CDS 100% 4.950 3.465 N FAM210B n/a
8 TRCN0000319295 CATTGCACATTGGAATCTCAT pLKO_005 337 CDS 100% 4.950 3.465 N FAM210B n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1700 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 1768 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1701 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080821.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.