Transcript: Human NM_080861.4

Homo sapiens splA/ryanodine receptor domain and SOCS box containing 3 (SPSB3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
SPSB3 (90864)
Length:
1535
CDS:
83..1150

Additional Resources:

NCBI RefSeq record:
NM_080861.4
NBCI Gene record:
SPSB3 (90864)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080861.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122723 CCGTAAGGTCAGCTTCCACAT pLKO.1 448 CDS 100% 4.050 5.670 N SPSB3 n/a
2 TRCN0000232557 TGGGTCTGGGATGACTTAAAT pLKO_005 395 CDS 100% 15.000 10.500 N SPSB3 n/a
3 TRCN0000232556 GCGGAGAGGAAGACGAGTATT pLKO_005 369 CDS 100% 13.200 9.240 N SPSB3 n/a
4 TRCN0000232558 TCAAGAACAGGAAGTGTATAG pLKO_005 783 CDS 100% 10.800 7.560 N SPSB3 n/a
5 TRCN0000121689 GAACAAGAGATTCTACCCGAT pLKO.1 826 CDS 100% 2.160 1.512 N SPSB3 n/a
6 TRCN0000257334 GGATGTGGACCTGGACAAATA pLKO_005 595 CDS 100% 13.200 7.920 N SPSB3 n/a
7 TRCN0000232559 TTCCCAGTGGAACTGCCTTCT pLKO_005 1156 3UTR 100% 4.050 2.430 N SPSB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080861.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09307 pDONR223 100% 99.5% 99.1% None (many diffs) n/a
2 ccsbBroad304_09307 pLX_304 0% 99.5% 99.1% V5 (many diffs) n/a
3 TRCN0000477665 ATGTGGAACCTGGCACAGTCAGGT pLX_317 39.7% 99.5% 99.1% V5 (many diffs) n/a
4 ccsbBroadEn_16060 pDONR223 0% 63.8% 63.9% None 1_384del;633A>G n/a
5 ccsbBroad304_16060 pLX_304 0% 63.8% 63.9% V5 1_384del;633A>G n/a
Download CSV