Transcript: Human NM_080866.3

Homo sapiens solute carrier family 22 member 9 (SLC22A9), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SLC22A9 (114571)
Length:
2366
CDS:
273..1934

Additional Resources:

NCBI RefSeq record:
NM_080866.3
NBCI Gene record:
SLC22A9 (114571)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080866.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043457 CTACGCTTCTTGTCTGGGATT pLKO.1 876 CDS 100% 4.050 5.670 N SLC22A9 n/a
2 TRCN0000424932 GCAATGAGCCTCATAACAAAT pLKO_005 900 CDS 100% 13.200 10.560 N SLC22A9 n/a
3 TRCN0000431717 TGCCCTTCTGGTATTGCATTT pLKO_005 987 CDS 100% 10.800 8.640 N SLC22A9 n/a
4 TRCN0000043456 CCTCCTGTCCTTTACGAGATT pLKO.1 1328 CDS 100% 4.950 3.960 N SLC22A9 n/a
5 TRCN0000043454 GCCAAGATGCACTCTTGAGAA pLKO.1 475 CDS 100% 0.495 0.347 N SLC22A9 n/a
6 TRCN0000043455 GCCATCATATTTGTGCCACAA pLKO.1 1539 CDS 100% 4.050 2.430 N SLC22A9 n/a
7 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2126 3UTR 100% 4.950 2.475 Y ORAI2 n/a
8 TRCN0000043453 CCTTCCTGAAACCAGGAACAA pLKO.1 1817 CDS 100% 0.495 0.248 Y SLC22A9 n/a
9 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2123 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080866.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04657 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04657 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_13033 pDONR223 100% 43% 33.4% None 507_661del;870_1659del n/a
4 ccsbBroad304_13033 pLX_304 0% 43% 33.4% V5 507_661del;870_1659del n/a
5 TRCN0000475411 ACTTGCTTGTCACAGCGCGCGGAC pLX_317 57.6% 43% 33.4% V5 507_661del;870_1659del n/a
Download CSV