Transcript: Human NM_080878.3

Homo sapiens intelectin 2 (ITLN2), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
ITLN2 (142683)
Length:
1161
CDS:
69..1046

Additional Resources:

NCBI RefSeq record:
NM_080878.3
NBCI Gene record:
ITLN2 (142683)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_080878.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423759 CGGCTGTACTCTTGTTCTATA pLKO_005 1021 CDS 100% 13.200 10.560 N ITLN2 n/a
2 TRCN0000180173 CGTTCAGTTCCGGGTGTTTAA pLKO.1 809 CDS 100% 13.200 10.560 N ITLN2 n/a
3 TRCN0000148177 GATATGGAACTCACGTTAAGA pLKO.1 973 CDS 100% 5.625 4.500 N ITLN2 n/a
4 TRCN0000429341 AGACTCTGCTTCCTGTTATTC pLKO_005 96 CDS 100% 13.200 9.240 N ITLN2 n/a
5 TRCN0000147469 CTATGACTTTGGTGATGCTAA pLKO.1 734 CDS 100% 4.950 3.465 N ITLN2 n/a
6 TRCN0000424580 GCCATACCTGTGGTCTATGAC pLKO_005 720 CDS 100% 4.950 3.465 N ITLN2 n/a
7 TRCN0000180796 GAAATCAAGGAACGCTGCCAT pLKO.1 231 CDS 100% 2.640 1.848 N ITLN2 n/a
8 TRCN0000147490 GCTAAGAAGACTGCATCTTAT pLKO.1 750 CDS 100% 1.320 0.924 N ITLN2 n/a
9 TRCN0000180452 GCACCAAGAATGGTGTTGTCT pLKO.1 280 CDS 100% 0.300 0.210 N ITLN2 n/a
10 TRCN0000162646 CCAACTACAACACCTTTGGAT pLKO.1 457 CDS 100% 3.000 1.500 Y ITLN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_080878.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13211 pDONR223 100% 99.5% 99.3% None 76_78delGCA;308G>A n/a
2 ccsbBroad304_13211 pLX_304 0% 99.5% 99.3% V5 76_78delGCA;308G>A n/a
3 TRCN0000472578 GCCGTCCGAACATACCGCTTTGAG pLX_317 39.3% 99.5% 99.3% V5 76_78delGCA;308G>A n/a
4 ccsbBroadEn_03606 pDONR223 100% 81.5% 80.9% None (many diffs) n/a
5 ccsbBroad304_03606 pLX_304 0% 81.5% 80.9% V5 (many diffs) n/a
6 TRCN0000473599 ACATATGGACTGTGCGACTCCTGT pLX_317 32.4% 81.5% 80.9% V5 (many diffs) n/a
Download CSV