Transcript: Mouse NM_130456.4

Mus musculus nephrosis 2, podocin (Nphs2), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Nphs2 (170484)
Length:
3124
CDS:
70..1227

Additional Resources:

NCBI RefSeq record:
NM_130456.4
NBCI Gene record:
Nphs2 (170484)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_130456.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112984 CTTCGATACTTGCACACTCTT pLKO.1 1036 CDS 100% 4.950 6.930 N Nphs2 n/a
2 TRCN0000112981 CCAAACCAGTTGAACCACTAA pLKO.1 1175 CDS 100% 4.950 3.960 N Nphs2 n/a
3 TRCN0000112983 CTTTGCCATTTGACATGCTAA pLKO.1 1097 CDS 100% 4.950 3.465 N Nphs2 n/a
4 TRCN0000112982 CAAGATGTAAAGGTTGCCTTA pLKO.1 802 CDS 100% 4.050 2.835 N Nphs2 n/a
5 TRCN0000112980 CGCACTTGTTTGGTTGCCAAA pLKO.1 1309 3UTR 100% 4.050 2.835 N Nphs2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130456.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11243 pDONR223 100% 69.8% 69.3% None (many diffs) n/a
2 ccsbBroadEn_14885 pDONR223 91.8% 69.8% 69.3% None (many diffs) n/a
3 ccsbBroad304_14885 pLX_304 0% 69.8% 69.3% V5 (many diffs) n/a
4 TRCN0000470834 GATGCGCTGATTGAGACCACCGAA pLX_317 49% 69.8% 69.3% V5 (many diffs) n/a
Download CSV