Transcript: Mouse NM_130796.4

Mus musculus sorting nexin 18 (Snx18), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Snx18 (170625)
Length:
4466
CDS:
170..2017

Additional Resources:

NCBI RefSeq record:
NM_130796.4
NBCI Gene record:
Snx18 (170625)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_130796.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379474 TGCGACGTCTTCCAGCATTTC pLKO_005 1256 CDS 100% 10.800 15.120 N Snx18 n/a
2 TRCN0000103842 GCCGAGATTCATCACTTCCAT pLKO.1 1877 CDS 100% 3.000 4.200 N Snx18 n/a
3 TRCN0000302706 GCCGAGATTCATCACTTCCAT pLKO_005 1877 CDS 100% 3.000 4.200 N Snx18 n/a
4 TRCN0000103840 CCACTGTGATTCACTCGTTTA pLKO.1 3002 3UTR 100% 10.800 8.640 N Snx18 n/a
5 TRCN0000302779 CCACTGTGATTCACTCGTTTA pLKO_005 3002 3UTR 100% 10.800 8.640 N Snx18 n/a
6 TRCN0000103843 GCAAGATAGATGGCTTCAAAT pLKO.1 1419 CDS 100% 13.200 9.240 N Snx18 n/a
7 TRCN0000302780 GCAAGATAGATGGCTTCAAAT pLKO_005 1419 CDS 100% 13.200 9.240 N Snx18 n/a
8 TRCN0000380760 TAAATCACAGATGCAACATTT pLKO_005 1918 CDS 100% 13.200 9.240 N Snx18 n/a
9 TRCN0000380979 CAAATACGACAGCGTCTAATG pLKO_005 1999 CDS 100% 10.800 7.560 N Snx18 n/a
10 TRCN0000103844 GAGATTCATCACTTCCATCAA pLKO.1 1880 CDS 100% 4.950 3.465 N Snx18 n/a
11 TRCN0000165826 GATCTGGTGGATGAACCACAT pLKO.1 1210 CDS 100% 4.050 2.835 N SNX18 n/a
12 TRCN0000103841 CCGCTGTAACACTATTTCCTT pLKO.1 1846 CDS 100% 3.000 2.100 N Snx18 n/a
13 TRCN0000302781 CCGCTGTAACACTATTTCCTT pLKO_005 1846 CDS 100% 3.000 2.100 N Snx18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130796.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16073 pDONR223 0% 89.5% 95.5% None (many diffs) n/a
2 ccsbBroad304_16073 pLX_304 0% 89.5% 95.5% V5 (many diffs) n/a
3 TRCN0000467806 CGGAATTGGTGCCGATAATAGGAT pLX_317 22% 89.5% 95.5% V5 (many diffs) n/a
Download CSV