Transcript: Mouse NM_133185.2

Mus musculus rogdi homolog (Rogdi), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rogdi (66049)
Length:
1392
CDS:
47..910

Additional Resources:

NCBI RefSeq record:
NM_133185.2
NBCI Gene record:
Rogdi (66049)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133185.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012237 GCTCAACGATGCCCTGGTATA pLKO.1 805 CDS 100% 10.800 15.120 N Rogdi n/a
2 TRCN0000012234 GCTGGTCAATGTCTACATCAA pLKO.1 610 CDS 100% 4.950 3.960 N Rogdi n/a
3 TRCN0000321276 GCTGGTCAATGTCTACATCAA pLKO_005 610 CDS 100% 4.950 3.960 N Rogdi n/a
4 TRCN0000321279 CCACGTGCACAAGGTAGAATG pLKO_005 772 CDS 100% 10.800 7.560 N Rogdi n/a
5 TRCN0000321348 CTCAACGATGCCCTGGTATAC pLKO_005 806 CDS 100% 10.800 7.560 N Rogdi n/a
6 TRCN0000012236 GCCTCGGAACAACCAGTTGTT pLKO.1 319 CDS 100% 0.495 0.347 N Rogdi n/a
7 TRCN0000012235 GAACCATGTGAGCCAAGCTAT pLKO.1 397 CDS 100% 4.950 2.970 N Rogdi n/a
8 TRCN0000321275 GAACCATGTGAGCCAAGCTAT pLKO_005 397 CDS 100% 4.950 2.970 N Rogdi n/a
9 TRCN0000012233 CCCTCCTCATTCCCTGTGGTA pLKO.1 1010 3UTR 100% 0.880 0.528 N Rogdi n/a
10 TRCN0000321277 CCCTCCTCATTCCCTGTGGTA pLKO_005 1010 3UTR 100% 0.880 0.528 N Rogdi n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133185.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08941 pDONR223 100% 87.9% 94.4% None (many diffs) n/a
2 ccsbBroad304_08941 pLX_304 0% 87.9% 94.4% V5 (many diffs) n/a
3 TRCN0000478692 CTCGTTACAATCCGGCTCGAGTAC pLX_317 42.6% 87.9% 94.4% V5 (many diffs) n/a
Download CSV