Transcript: Mouse NM_133206.3

Mus musculus zinc and ring finger 1 (Znrf1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-03-19
Taxon:
Mus musculus (mouse)
Gene:
Znrf1 (170737)
Length:
5562
CDS:
502..1185

Additional Resources:

NCBI RefSeq record:
NM_133206.3
NBCI Gene record:
Znrf1 (170737)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133206.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040744 ACAATGATGATGTGCTGACTA pLKO.1 1016 CDS 100% 4.950 6.930 N Znrf1 n/a
2 TRCN0000040745 GAGATGGAAATGCACTTTATA pLKO.1 967 CDS 100% 15.000 10.500 N Znrf1 n/a
3 TRCN0000040743 CATGGTTTGAAGTGAACAGAT pLKO.1 1139 CDS 100% 4.950 3.465 N Znrf1 n/a
4 TRCN0000040746 TGCCTGTGCATCTATCACAAA pLKO.1 1105 CDS 100% 4.950 3.465 N Znrf1 n/a
5 TRCN0000040747 CGGTCACCATAGAGACGGGAT pLKO.1 825 CDS 100% 0.720 0.360 Y Znrf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133206.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04450 pDONR223 100% 95% 99.1% None (many diffs) n/a
2 ccsbBroad304_04450 pLX_304 0% 95% 99.1% V5 (many diffs) n/a
3 TRCN0000479058 GGGCAGGTCATACCACCGTCCTCA pLX_317 57.6% 95% 99.1% V5 (many diffs) n/a
Download CSV