Transcript: Mouse NM_133216.3

Mus musculus X-prolyl aminopeptidase (aminopeptidase P) 1, soluble (Xpnpep1), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Xpnpep1 (170750)
Length:
2521
CDS:
110..2110

Additional Resources:

NCBI RefSeq record:
NM_133216.3
NBCI Gene record:
Xpnpep1 (170750)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133216.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428268 AGACGATCATGCTCTTCATTG pLKO_005 930 CDS 100% 10.800 15.120 N XPNPEP1 n/a
2 TRCN0000031934 GCTCACATTAAAGATGCCGTT pLKO.1 1235 CDS 100% 2.160 3.024 N Xpnpep1 n/a
3 TRCN0000031935 CGAGATTGCATGGCTGTTCAA pLKO.1 847 CDS 100% 4.950 3.465 N Xpnpep1 n/a
4 TRCN0000324858 CGAGATTGCATGGCTGTTCAA pLKO_005 847 CDS 100% 4.950 3.465 N Xpnpep1 n/a
5 TRCN0000031938 TGTGGGATTCTGGTCTGGATT pLKO.1 1665 CDS 100% 4.950 3.465 N Xpnpep1 n/a
6 TRCN0000324856 TGTGGGATTCTGGTCTGGATT pLKO_005 1665 CDS 100% 4.950 3.465 N Xpnpep1 n/a
7 TRCN0000031937 CACAGATTACTGGAAGAAGAT pLKO.1 613 CDS 100% 4.950 2.970 N Xpnpep1 n/a
8 TRCN0000324770 CACAGATTACTGGAAGAAGAT pLKO_005 613 CDS 100% 4.950 2.970 N Xpnpep1 n/a
9 TRCN0000031936 GCCTGACCTTTGAACCTCTAA pLKO.1 1905 CDS 100% 4.950 2.970 N Xpnpep1 n/a
10 TRCN0000324857 GCCTGACCTTTGAACCTCTAA pLKO_005 1905 CDS 100% 4.950 2.970 N Xpnpep1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133216.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11222 pDONR223 100% 82.4% 89.6% None (many diffs) n/a
2 ccsbBroad304_11222 pLX_304 0% 82.4% 89.6% V5 (many diffs) n/a
3 TRCN0000470726 CTGCACAGCCGGGGGATGACAACG pLX_317 24.4% 82.4% 89.6% V5 (many diffs) n/a
Download CSV