Transcript: Human NM_133263.4

Homo sapiens PPARG coactivator 1 beta (PPARGC1B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
PPARGC1B (133522)
Length:
10569
CDS:
34..3105

Additional Resources:

NCBI RefSeq record:
NM_133263.4
NBCI Gene record:
PPARGC1B (133522)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133263.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008600 GCATAGTCTAGGCAAAGAAAT pLKO.1 1908 CDS 100% 13.200 18.480 N PPARGC1B n/a
2 TRCN0000111965 CCTTCCAATATGTTTACGTTT pLKO.1 3152 3UTR 100% 4.950 6.930 N Ppargc1b n/a
3 TRCN0000008597 CCCTCGAGGAATACCTCAATA pLKO.1 3118 3UTR 100% 0.000 0.000 N PPARGC1B n/a
4 TRCN0000429958 AGCAACTCTATGCTGACTTTC pLKO_005 131 CDS 100% 10.800 7.560 N PPARGC1B n/a
5 TRCN0000008599 CCAGAGAACTCAGAGACTGAA pLKO.1 226 CDS 100% 4.950 3.465 N PPARGC1B n/a
6 TRCN0000008598 CCTGAGTATGACACTGTCTTT pLKO.1 2389 CDS 100% 4.950 3.465 N PPARGC1B n/a
7 TRCN0000008601 CCCAGATACACTGACTACGAT pLKO.1 2986 CDS 100% 3.000 2.100 N PPARGC1B n/a
8 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 1334 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133263.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09548 pDONR223 100% 99.9% .4% None 2_3insG n/a
2 ccsbBroad304_09548 pLX_304 0% 99.9% .4% V5 (not translated due to prior stop codon) 2_3insG n/a
3 TRCN0000477546 TCATACCGTCTACGAGTTAGATCC pLX_317 14.3% 99.9% .4% V5 (not translated due to prior stop codon) 2_3insG n/a
Download CSV