Transcript: Human NM_133443.4

Homo sapiens glutamic--pyruvic transaminase 2 (GPT2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GPT2 (84706)
Length:
3992
CDS:
129..1700

Additional Resources:

NCBI RefSeq record:
NM_133443.4
NBCI Gene record:
GPT2 (84706)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133443.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232859 CCTAAGGTGCTCTGCATAATC pLKO_005 909 CDS 100% 13.200 18.480 N GPT2 n/a
2 TRCN0000232858 GACGCCATCCAGGTGAATTAC pLKO_005 807 CDS 100% 13.200 18.480 N GPT2 n/a
3 TRCN0000035024 CGGCATTTCTACGATCCTGAA pLKO.1 695 CDS 100% 4.050 3.240 N GPT2 n/a
4 TRCN0000232862 TGCTTGCTGTGTGGTATATAA pLKO_005 3310 3UTR 100% 15.000 10.500 N GPT2 n/a
5 TRCN0000232860 TAGAAGATGTGATCCACTTTG pLKO_005 973 CDS 100% 10.800 7.560 N GPT2 n/a
6 TRCN0000035025 CCATCAAATGGCTCCAGACAT pLKO.1 1499 CDS 100% 4.950 3.465 N GPT2 n/a
7 TRCN0000035026 CCACATCAACTTCCTGGAGAA pLKO.1 1670 CDS 100% 4.050 2.835 N GPT2 n/a
8 TRCN0000035028 GACAACGTGTACTCTCCAGAT pLKO.1 1038 CDS 100% 4.050 2.835 N GPT2 n/a
9 TRCN0000035027 CTGCATAATCAACCCTGGGAA pLKO.1 920 CDS 100% 2.640 1.848 N GPT2 n/a
10 TRCN0000232861 TACCACTTCAGGATGACTATC pLKO_005 1599 CDS 100% 0.000 0.000 N GPT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133443.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04417 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04417 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000492245 TGCCCCCTTGAGTGATGTTAGTGA pLX_317 27.4% 100% 100% V5 n/a
Download CSV