Transcript: Human NM_133445.3

Homo sapiens glutamate ionotropic receptor NMDA type subunit 3A (GRIN3A), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
GRIN3A (116443)
Length:
7838
CDS:
669..4016

Additional Resources:

NCBI RefSeq record:
NM_133445.3
NBCI Gene record:
GRIN3A (116443)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133445.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063223 CGCCAACATATCCGAGCTAAT pLKO.1 3320 CDS 100% 10.800 15.120 N GRIN3A n/a
2 TRCN0000063227 CCCACTTCCAACATCCAAGTA pLKO.1 2182 CDS 100% 4.950 3.960 N GRIN3A n/a
3 TRCN0000415844 CATTGGTGAGCACATAGTATA pLKO_005 3515 CDS 100% 13.200 9.240 N GRIN3A n/a
4 TRCN0000063224 CCTCCTCCTTACCCAGAATAA pLKO.1 1505 CDS 100% 13.200 9.240 N GRIN3A n/a
5 TRCN0000422573 CGTAACACAGAACGAGGTTAT pLKO_005 4414 3UTR 100% 10.800 7.560 N GRIN3A n/a
6 TRCN0000063226 GCTACCCTACAACCTGTCTTT pLKO.1 1091 CDS 100% 4.950 3.465 N GRIN3A n/a
7 TRCN0000063225 GCTGAAGATTATGTGAGACAA pLKO.1 3072 CDS 100% 4.950 3.465 N GRIN3A n/a
8 TRCN0000100220 GCTCCATGACAAGTGGTACAA pLKO.1 3374 CDS 100% 4.950 2.970 N Grin3b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133445.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14360 pDONR223 100% 99.8% 17.9% None (many diffs) n/a
2 ccsbBroad304_14360 pLX_304 0% 99.8% 17.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000480025 CCCTACAGCAACTAATAGAGTTTA pLX_317 9.8% 99.8% 17.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV