Transcript: Human NM_133446.3

Homo sapiens ArfGAP with GTPase domain, ankyrin repeat and PH domain 4 (AGAP4), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
AGAP4 (119016)
Length:
2451
CDS:
127..2118

Additional Resources:

NCBI RefSeq record:
NM_133446.3
NBCI Gene record:
AGAP4 (119016)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263045 ATGGCGTGCTCACCTATTATT pLKO_005 986 CDS 100% 15.000 7.500 Y AGAP4 n/a
2 TRCN0000048386 CCCTCTCCTCATGCCAATAAA pLKO.1 1234 CDS 100% 15.000 7.500 Y BMS1P1 n/a
3 TRCN0000262358 CGGTGGATCCGTTCCAAATAT pLKO_005 1750 CDS 100% 15.000 7.500 Y AGAP6 n/a
4 TRCN0000152610 GCCTGAAGCTTTGGAGTTTAA pLKO.1 342 CDS 100% 13.200 6.600 Y AGAP4 n/a
5 TRCN0000282213 TACAGCTTGTGTTCGACAATA pLKO_005 481 CDS 100% 13.200 6.600 Y AGAP6 n/a
6 TRCN0000262356 TGCGCTGGTCCAACCTGTTTA pLKO_005 800 CDS 100% 13.200 6.600 Y AGAP6 n/a
7 TRCN0000263044 GAAATCACAAATTCAGCTAAT pLKO_005 2197 3UTR 100% 10.800 5.400 Y AGAP4 n/a
8 TRCN0000263046 TTGGAGATACCTCATCATATC pLKO_005 562 CDS 100% 10.800 5.400 Y AGAP4 n/a
9 TRCN0000151705 CACAAAGAGATGCAGATAGAT pLKO.1 584 CDS 100% 5.625 2.813 Y AGAP4 n/a
10 TRCN0000152204 CAGGAAGGTTATGTCATCTAT pLKO.1 1641 CDS 100% 5.625 2.813 Y AGAP4 n/a
11 TRCN0000048384 CCTTGGAGATACCTCATCATA pLKO.1 560 CDS 100% 5.625 2.813 Y BMS1P1 n/a
12 TRCN0000153941 CCTTGGAGATACCTCATCATA pLKO.1 560 CDS 100% 5.625 2.813 Y AGAP4 n/a
13 TRCN0000048327 CCTTCAGACATCTACCATCAA pLKO.1 1053 CDS 100% 4.950 2.475 Y LOC143158 n/a
14 TRCN0000153940 CCTTCAGACATCTACCATCAA pLKO.1 1053 CDS 100% 4.950 2.475 Y AGAP4 n/a
15 TRCN0000156808 GAATCCTAAGTGGGCCAGTTT pLKO.1 1512 CDS 100% 4.950 2.475 Y AGAP4 n/a
16 TRCN0000048405 GTGTATTGAATGCTCAGGAAT pLKO.1 1551 CDS 100% 4.950 2.475 Y AGAP5 n/a
17 TRCN0000048324 CCATGTATCTACTGTGCGTTT pLKO.1 450 CDS 100% 4.050 2.025 Y LOC143158 n/a
18 TRCN0000153993 CCATGTATCTACTGTGCGTTT pLKO.1 450 CDS 100% 4.050 2.025 Y AGAP4 n/a
19 TRCN0000048399 CCGTTCCAAATATGAGGAGAA pLKO.1 1758 CDS 100% 4.050 2.025 Y AGAP7P n/a
20 TRCN0000154162 CCGTTCCAAATATGAGGAGAA pLKO.1 1758 CDS 100% 4.050 2.025 Y AGAP4 n/a
21 TRCN0000048403 AGGAAATCACAAATTCAGCTA pLKO.1 2195 3UTR 100% 2.640 1.320 Y AGAP5 n/a
22 TRCN0000154067 CCAACCTGTTTACATCTGAGA pLKO.1 809 CDS 100% 2.640 1.320 Y AGAP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133446.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.