Transcript: Human NM_133484.1

Homo sapiens TRAF family member associated NFKB activator (TANK), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
TANK (10010)
Length:
698
CDS:
159..518

Additional Resources:

NCBI RefSeq record:
NM_133484.1
NBCI Gene record:
TANK (10010)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133484.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303903 TCCACTCAAGATAACAATTAT pLKO_005 357 CDS 100% 15.000 21.000 N TANK n/a
2 TRCN0000107254 GCTGTCACTTCAACAGACTAT pLKO.1 299 CDS 100% 4.950 3.465 N TANK n/a
3 TRCN0000054846 CCATCCTTTATAGTGATGCTA pLKO.1 124 5UTR 100% 3.000 2.100 N Tank n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133484.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02289 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02289 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468191 CACCAAATTACTAGTTGCAACATA pLX_317 94.6% 100% 100% V5 n/a
4 ccsbBroadEn_07531 pDONR223 100% 27.7% 26.1% None (many diffs) n/a
5 ccsbBroad304_07531 pLX_304 0% 27.7% 26.1% V5 (many diffs) n/a
6 TRCN0000481327 TCACTCCACTAATATAAGTACCTC pLX_317 22.2% 27.7% 26.1% V5 (many diffs) n/a
Download CSV