Transcript: Human NM_133502.3

Homo sapiens zinc finger protein 274 (ZNF274), transcript variant ZNF274c, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZNF274 (10782)
Length:
2808
CDS:
428..2389

Additional Resources:

NCBI RefSeq record:
NM_133502.3
NBCI Gene record:
ZNF274 (10782)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133502.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229702 ACCTTCAGTCGGAGTACTAAA pLKO_005 1886 CDS 100% 13.200 18.480 N ZNF274 n/a
2 TRCN0000229701 CAAACGTGACTCACAAGTTAA pLKO_005 1780 CDS 100% 13.200 18.480 N ZNF274 n/a
3 TRCN0000229700 TTCCGGCAGTTCCGTTATAAG pLKO_005 917 CDS 100% 13.200 18.480 N ZNF274 n/a
4 TRCN0000014855 CGCAAACGTGACTCACAAGTT pLKO.1 1778 CDS 100% 4.950 6.930 N ZNF274 n/a
5 TRCN0000014853 CCACAATAGGACAAAGCGAAA pLKO.1 2347 CDS 100% 4.050 5.670 N ZNF274 n/a
6 TRCN0000014856 GCCCATATGCATGCAACAAAT pLKO.1 2277 CDS 100% 0.000 0.000 N ZNF274 n/a
7 TRCN0000219005 TCTTGACACAAACCAAGTTTC pLKO_005 1660 CDS 100% 10.800 7.560 N ZNF274 n/a
8 TRCN0000014854 CCAGCCTGAAAGTACAAGAAT pLKO.1 1476 CDS 100% 5.625 3.938 N ZNF274 n/a
9 TRCN0000014857 CAGGCCCTATATGCTGAAGAT pLKO.1 812 CDS 100% 4.950 3.465 N ZNF274 n/a
10 TRCN0000229703 TGTTCACTCATTTAGTCATTA pLKO_005 2623 3UTR 100% 13.200 7.920 N ZNF274 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133502.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07679 pDONR223 100% 99.9% 99.8% None 439G>A n/a
2 ccsbBroad304_07679 pLX_304 0% 99.9% 99.8% V5 439G>A n/a
3 TRCN0000474016 CCGCTAGCAGTTTAACTAGCCATC pLX_317 20.4% 99.9% 99.8% V5 439G>A n/a
Download CSV