Transcript: Mouse NM_133746.5

Mus musculus calcium homeostasis modulator 2 (Calhm2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Calhm2 (72691)
Length:
2049
CDS:
553..1524

Additional Resources:

NCBI RefSeq record:
NM_133746.5
NBCI Gene record:
Calhm2 (72691)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133746.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193365 CCTTCATTGTATAGTACACTT pLKO.1 1890 3UTR 100% 4.950 6.930 N Calhm2 n/a
2 TRCN0000194341 CTGTATGGACTGACAGCAATT pLKO.1 715 CDS 100% 10.800 7.560 N Calhm2 n/a
3 TRCN0000194584 CTGACCAAGTGCCTCAAACAT pLKO.1 1153 CDS 100% 5.625 3.938 N Calhm2 n/a
4 TRCN0000173470 GCTCACAGCTATCAGAAAGTA pLKO.1 1768 3UTR 100% 5.625 3.938 N Calhm2 n/a
5 TRCN0000162181 CAAGAGCAAGGATGTGATGAT pLKO.1 600 CDS 100% 4.950 3.465 N CALHM2 n/a
6 TRCN0000162359 CTTCAAGAGCAAGGATGTGAT pLKO.1 597 CDS 100% 4.950 3.465 N CALHM2 n/a
7 TRCN0000173893 GCCTGCTTCTATGCTCTGTAA pLKO.1 1527 3UTR 100% 4.950 3.465 N Calhm2 n/a
8 TRCN0000173987 GTCTGTGCTCTCAGTGAGTTT pLKO.1 937 CDS 100% 4.950 3.465 N Calhm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133746.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08207 pDONR223 100% 87% 91.9% None (many diffs) n/a
2 ccsbBroad304_08207 pLX_304 0% 87% 91.9% V5 (many diffs) n/a
3 TRCN0000465862 AAACGTCGCGTCCATGCTGTTGCC pLX_317 32.9% 87% 91.9% V5 (many diffs) n/a
Download CSV