Transcript: Mouse NM_133795.1

Mus musculus tetratricopeptide repeat domain 1 (Ttc1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Ttc1 (66827)
Length:
1469
CDS:
86..964

Additional Resources:

NCBI RefSeq record:
NM_133795.1
NBCI Gene record:
Ttc1 (66827)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133795.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115161 CCTGATGTATGAGCCTCATTA pLKO.1 1129 3UTR 100% 13.200 10.560 N Ttc1 n/a
2 TRCN0000354042 CCTGATGTATGAGCCTCATTA pLKO_005 1129 3UTR 100% 13.200 10.560 N Ttc1 n/a
3 TRCN0000115163 GCGGTTTAAGAGAGGAGATTA pLKO.1 460 CDS 100% 13.200 10.560 N Ttc1 n/a
4 TRCN0000354041 GCGGTTTAAGAGAGGAGATTA pLKO_005 460 CDS 100% 13.200 10.560 N Ttc1 n/a
5 TRCN0000115162 CCCACCTATATCCGTGCAATA pLKO.1 641 CDS 100% 10.800 7.560 N Ttc1 n/a
6 TRCN0000325263 CCCACCTATATCCGTGCAATA pLKO_005 641 CDS 100% 10.800 7.560 N Ttc1 n/a
7 TRCN0000115164 CCAGCCTGTTTCCAGAAAGAT pLKO.1 524 CDS 100% 5.625 3.938 N Ttc1 n/a
8 TRCN0000325265 CCAGCCTGTTTCCAGAAAGAT pLKO_005 524 CDS 100% 5.625 3.938 N Ttc1 n/a
9 TRCN0000115165 GTATGAGATTACCTAAGCAAA pLKO.1 771 CDS 100% 4.950 3.465 N Ttc1 n/a
10 TRCN0000325264 GTATGAGATTACCTAAGCAAA pLKO_005 771 CDS 100% 4.950 3.465 N Ttc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133795.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07105 pDONR223 100% 83.9% 82.9% None (many diffs) n/a
2 ccsbBroad304_07105 pLX_304 0% 83.9% 82.9% V5 (many diffs) n/a
3 TRCN0000481043 ACCCAATAAGCACCCAAAGTAGCA pLX_317 59.3% 83.9% 82.9% V5 (many diffs) n/a
Download CSV