Transcript: Mouse NM_133816.2

Mus musculus SH3-domain binding protein 4 (Sh3bp4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sh3bp4 (98402)
Length:
3673
CDS:
343..3231

Additional Resources:

NCBI RefSeq record:
NM_133816.2
NBCI Gene record:
Sh3bp4 (98402)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133816.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329184 CTCCTACGTGCAGCCATTAAA pLKO_005 660 CDS 100% 15.000 21.000 N Sh3bp4 n/a
2 TRCN0000120980 CCGTGTGGGATTTCATCAATA pLKO.1 1733 CDS 100% 13.200 18.480 N Sh3bp4 n/a
3 TRCN0000120979 GCCCTATAGTAACAACCCTTT pLKO.1 807 CDS 100% 4.050 5.670 N Sh3bp4 n/a
4 TRCN0000329180 GCCCTATAGTAACAACCCTTT pLKO_005 807 CDS 100% 4.050 5.670 N Sh3bp4 n/a
5 TRCN0000120978 GCAGCCATTAAACTACCGGAA pLKO.1 669 CDS 100% 2.160 3.024 N Sh3bp4 n/a
6 TRCN0000329183 CCCAGTACGGATGAGCTAAAC pLKO_005 874 CDS 100% 10.800 8.640 N Sh3bp4 n/a
7 TRCN0000329257 ATGTTCTCCAATATGACTAAC pLKO_005 1960 CDS 100% 10.800 7.560 N Sh3bp4 n/a
8 TRCN0000120977 GCCAATTGTGTTGCTTTCTAT pLKO.1 3507 3UTR 100% 5.625 3.938 N Sh3bp4 n/a
9 TRCN0000329181 GCCAATTGTGTTGCTTTCTAT pLKO_005 3507 3UTR 100% 5.625 3.938 N Sh3bp4 n/a
10 TRCN0000120981 CAGAGTGTGTATGTTCTCCAA pLKO.1 1950 CDS 100% 2.640 1.848 N Sh3bp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133816.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02830 pDONR223 100% 85.7% 91.5% None (many diffs) n/a
2 ccsbBroad304_02830 pLX_304 0% 85.7% 91.5% V5 (many diffs) n/a
3 ccsbBroadEn_15021 pDONR223 0% 85.7% 91.5% None (many diffs) n/a
4 ccsbBroad304_15021 pLX_304 0% 85.7% 91.5% V5 (many diffs) n/a
5 TRCN0000468043 CATACAATATCCGGCGAACTCTTT pLX_317 13.3% 85.7% 91.5% V5 (many diffs) n/a
Download CSV