Transcript: Mouse NM_133835.2

Mus musculus ubiquitin associated domain containing 1 (Ubac1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ubac1 (98766)
Length:
3450
CDS:
227..1456

Additional Resources:

NCBI RefSeq record:
NM_133835.2
NBCI Gene record:
Ubac1 (98766)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133835.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113263 CCTAAGACATTGCTAGCATTT pLKO.1 1325 CDS 100% 10.800 7.560 N Ubac1 n/a
2 TRCN0000325481 CCTAAGACATTGCTAGCATTT pLKO_005 1325 CDS 100% 10.800 7.560 N Ubac1 n/a
3 TRCN0000113262 GCTCCAGACAAAGATGCTATT pLKO.1 578 CDS 100% 10.800 7.560 N Ubac1 n/a
4 TRCN0000325422 GCTCCAGACAAAGATGCTATT pLKO_005 578 CDS 100% 10.800 7.560 N Ubac1 n/a
5 TRCN0000113264 GCAAATGCTATGCTGGATGAA pLKO.1 764 CDS 100% 4.950 3.465 N Ubac1 n/a
6 TRCN0000325419 GCAAATGCTATGCTGGATGAA pLKO_005 764 CDS 100% 4.950 3.465 N Ubac1 n/a
7 TRCN0000113260 GCTCCTGAAGTGCTACTTGAA pLKO.1 1703 3UTR 100% 4.950 3.465 N Ubac1 n/a
8 TRCN0000325482 GCTCCTGAAGTGCTACTTGAA pLKO_005 1703 3UTR 100% 4.950 3.465 N Ubac1 n/a
9 TRCN0000113261 CCAGCTATTGACACACCTCTT pLKO.1 929 CDS 100% 4.050 2.835 N Ubac1 n/a
10 TRCN0000353980 CCAGCTATTGACACACCTCTT pLKO_005 929 CDS 100% 4.050 2.835 N Ubac1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133835.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02424 pDONR223 100% 84.4% 89.5% None (many diffs) n/a
2 ccsbBroad304_02424 pLX_304 0% 84.4% 89.5% V5 (many diffs) n/a
3 TRCN0000474216 TTACAGCTCTGTTCCGTCCGGCTA pLX_317 37% 84.4% 89.5% V5 (many diffs) n/a
Download CSV