Transcript: Mouse NM_133838.4

Mus musculus EH-domain containing 4 (Ehd4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ehd4 (98878)
Length:
3387
CDS:
101..1726

Additional Resources:

NCBI RefSeq record:
NM_133838.4
NBCI Gene record:
Ehd4 (98878)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133838.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093581 CGAGTCTACATTGGTTCATTT pLKO.1 860 CDS 100% 13.200 18.480 N Ehd4 n/a
2 TRCN0000324386 CGAGTCTACATTGGTTCATTT pLKO_005 860 CDS 100% 13.200 18.480 N Ehd4 n/a
3 TRCN0000093580 CCGGTGTATGACGAACTCTTT pLKO.1 1445 CDS 100% 4.950 6.930 N Ehd4 n/a
4 TRCN0000324456 CCGGTGTATGACGAACTCTTT pLKO_005 1445 CDS 100% 4.950 6.930 N Ehd4 n/a
5 TRCN0000093583 CAAGCACCTCATCAAGATCAA pLKO.1 1621 CDS 100% 4.950 3.465 N Ehd4 n/a
6 TRCN0000324385 CAAGCACCTCATCAAGATCAA pLKO_005 1621 CDS 100% 4.950 3.465 N Ehd4 n/a
7 TRCN0000093579 GCCACCATTCACACTTCCTAT pLKO.1 3136 3UTR 100% 4.950 3.465 N Ehd4 n/a
8 TRCN0000324387 GCCACCATTCACACTTCCTAT pLKO_005 3136 3UTR 100% 4.950 3.465 N Ehd4 n/a
9 TRCN0000093582 GCTTTAGTTGTGGATCCCAAA pLKO.1 446 CDS 100% 4.050 2.835 N Ehd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133838.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15810 pDONR223 0% 90.8% 97% None (many diffs) n/a
2 ccsbBroad304_15810 pLX_304 0% 90.8% 97% V5 (many diffs) n/a
3 TRCN0000469088 ACGCATTCCTCCAAGCATGAGTTC pLX_317 27.2% 90.8% 97% V5 (many diffs) n/a
Download CSV