Transcript: Mouse NM_133933.4

Mus musculus ribophorin I (Rpn1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rpn1 (103963)
Length:
3642
CDS:
59..1885

Additional Resources:

NCBI RefSeq record:
NM_133933.4
NBCI Gene record:
Rpn1 (103963)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133933.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094040 CGTCCTTGATTATGGGCCTTT pLKO.1 649 CDS 100% 4.050 5.670 N Rpn1 n/a
2 TRCN0000326671 CGTCCTTGATTATGGGCCTTT pLKO_005 649 CDS 100% 4.050 5.670 N Rpn1 n/a
3 TRCN0000094039 CCCATGAAGAATGTAGAATTA pLKO.1 3416 3UTR 100% 13.200 9.240 N Rpn1 n/a
4 TRCN0000094043 CGGGATGAGATTGGTAATGTT pLKO.1 941 CDS 100% 5.625 3.938 N Rpn1 n/a
5 TRCN0000326669 CGGGATGAGATTGGTAATGTT pLKO_005 941 CDS 100% 5.625 3.938 N Rpn1 n/a
6 TRCN0000094042 GCACTGAAGATGCGGTTTGTA pLKO.1 1109 CDS 100% 5.625 3.938 N Rpn1 n/a
7 TRCN0000326746 GCACTGAAGATGCGGTTTGTA pLKO_005 1109 CDS 100% 5.625 3.938 N Rpn1 n/a
8 TRCN0000072591 CCATTATTTCTACTCTCCCTA pLKO.1 538 CDS 100% 2.640 1.848 N RPN1 n/a
9 TRCN0000094041 CCAAGCTATGAATACCTCTAT pLKO.1 1070 CDS 100% 4.950 2.970 N Rpn1 n/a
10 TRCN0000326670 CCAAGCTATGAATACCTCTAT pLKO_005 1070 CDS 100% 4.950 2.970 N Rpn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133933.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06888 pDONR223 100% 87.7% 95% None (many diffs) n/a
2 ccsbBroad304_06888 pLX_304 0% 87.7% 95% V5 (many diffs) n/a
3 TRCN0000466360 AACACTTTGTTCCTTAGACAGTAA pLX_317 21.9% 87.7% 95% V5 (many diffs) n/a
Download CSV