Transcript: Mouse NM_133934.4

Mus musculus ISY1 splicing factor homolog (Isy1), mRNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Mus musculus (mouse)
Gene:
Isy1 (57905)
Length:
1620
CDS:
114..971

Additional Resources:

NCBI RefSeq record:
NM_133934.4
NBCI Gene record:
Isy1 (57905)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133934.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123670 CGGGACCTGAATGACGAAATT pLKO.1 324 CDS 100% 13.200 18.480 N Isy1 n/a
2 TRCN0000353921 CGGGACCTGAATGACGAAATT pLKO_005 324 CDS 100% 13.200 18.480 N Isy1 n/a
3 TRCN0000123673 GCTCCAGAAATATGCAAGTGA pLKO.1 902 CDS 100% 3.000 4.200 N Isy1 n/a
4 TRCN0000324305 GCTCCAGAAATATGCAAGTGA pLKO_005 902 CDS 100% 3.000 4.200 N Isy1 n/a
5 TRCN0000123672 CCTGGTGTCAGAGAGCTATTT pLKO.1 501 CDS 100% 13.200 9.240 N Isy1 n/a
6 TRCN0000324304 CCTGGTGTCAGAGAGCTATTT pLKO_005 501 CDS 100% 13.200 9.240 N Isy1 n/a
7 TRCN0000123669 CCCTTCAGCTTACCTCCATTT pLKO.1 1103 3UTR 100% 10.800 7.560 N Isy1 n/a
8 TRCN0000324236 CCCTTCAGCTTACCTCCATTT pLKO_005 1103 3UTR 100% 10.800 7.560 N Isy1 n/a
9 TRCN0000123671 CCCAGGAAATCGAGGTTACAA pLKO.1 455 CDS 100% 5.625 3.938 N Isy1 n/a
10 TRCN0000075131 GCTCAGATTCAGAATGCTGGT pLKO.1 285 CDS 100% 2.160 1.512 N ISY1 n/a
11 TRCN0000290267 GCTCAGATTCAGAATGCTGGT pLKO_005 285 CDS 100% 2.160 1.512 N ISY1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133934.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03823 pDONR223 100% 89.3% 98.2% None (many diffs) n/a
2 ccsbBroad304_03823 pLX_304 0% 89.3% 98.2% V5 (many diffs) n/a
3 TRCN0000477283 AGCCCGACGAAGATAGAGGTATTT pLX_317 43.3% 89.3% 98.2% V5 (many diffs) n/a
Download CSV