Transcript: Mouse NM_133986.2

Mus musculus T cell leukemia translocation altered gene (Tcta), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tcta (102791)
Length:
1840
CDS:
216..584

Additional Resources:

NCBI RefSeq record:
NM_133986.2
NBCI Gene record:
Tcta (102791)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133986.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366911 CCGCTGGCTCCTATGCTATTT pLKO_005 627 3UTR 100% 13.200 18.480 N Tcta n/a
2 TRCN0000126625 GCTCCACACATTTCTCTTCAT pLKO.1 520 CDS 100% 4.950 3.960 N Tcta n/a
3 TRCN0000376830 ACACAGTGACCGGGTTGTATC pLKO_005 409 CDS 100% 10.800 7.560 N Tcta n/a
4 TRCN0000376831 ACATGCGAGTGACTCTCTTCA pLKO_005 322 CDS 100% 4.950 3.465 N Tcta n/a
5 TRCN0000126627 GAACACAGTGACCGGGTTGTA pLKO.1 407 CDS 100% 4.950 3.465 N Tcta n/a
6 TRCN0000126626 GCAGCAAATGAAGCTCTCAAA pLKO.1 549 CDS 100% 4.950 3.465 N Tcta n/a
7 TRCN0000126624 GCAGGTGAAGTTTGTCTCTTA pLKO.1 774 3UTR 100% 4.950 3.465 N Tcta n/a
8 TRCN0000375938 CAGAATGGATCCACACCTGAT pLKO_005 498 CDS 100% 4.050 2.835 N Tcta n/a
9 TRCN0000142431 GCTGTGGTTGGTGTTAAGTCT pLKO.1 353 CDS 100% 3.000 2.100 N TCTA n/a
10 TRCN0000375936 GAGAATAAGGGAAGGCAGCAG pLKO_005 577 CDS 100% 2.160 1.512 N Tcta n/a
11 TRCN0000126628 GCAGCGACTTTCTGCGGGAGT pLKO.1 289 CDS 100% 0.000 0.000 N Tcta n/a
12 TRCN0000366912 CATGGGAGATAGCAGCAAATG pLKO_005 538 CDS 100% 10.800 6.480 N Tcta n/a
13 TRCN0000375997 TCCTGCAGCTATGGGTGTGTT pLKO_005 455 CDS 100% 4.950 2.970 N Tcta n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133986.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01654 pDONR223 100% 75.1% 77.8% None (many diffs) n/a
2 ccsbBroad304_01654 pLX_304 0% 75.1% 77.8% V5 (many diffs) n/a
3 TRCN0000475248 TGGCGGGTGCACAAAGTCTATTCA pLX_317 100% 75.1% 77.8% V5 (many diffs) n/a
Download CSV