Transcript: Mouse NM_134003.1

Mus musculus zinc finger CCCH type containing 10 (Zc3h10), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Zc3h10 (103284)
Length:
2102
CDS:
168..1475

Additional Resources:

NCBI RefSeq record:
NM_134003.1
NBCI Gene record:
Zc3h10 (103284)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196226 GCAAGTTTCGTCACCTGCAAA pLKO.1 628 CDS 100% 4.950 6.930 N Zc3h10 n/a
2 TRCN0000179060 CCGTCATGATCTCTATGACAT pLKO.1 725 CDS 100% 0.495 0.693 N Zc3h10 n/a
3 TRCN0000257043 GACGCCGTCATGATCTCTATG pLKO_005 721 CDS 100% 10.800 8.640 N Zc3h10 n/a
4 TRCN0000217839 CATGAGTGAGGTATCCAATTT pLKO.1 353 CDS 100% 13.200 9.240 N Zc3h10 n/a
5 TRCN0000241950 CATGAGTGAGGTATCCAATTT pLKO_005 353 CDS 100% 13.200 9.240 N Zc3h10 n/a
6 TRCN0000184782 CCACTACTCCTATGGTGACTT pLKO.1 1408 CDS 100% 4.950 3.465 N Zc3h10 n/a
7 TRCN0000162920 GAATCACAATGAGCCACACCA pLKO.1 1390 CDS 100% 2.640 1.848 N ZC3H10 n/a
8 TRCN0000241949 GAGGATGAGGATGGCTATAAG pLKO_005 465 CDS 100% 13.200 7.920 N Zc3h10 n/a
9 TRCN0000241951 TCAGGAGCAAAGACCTCATAT pLKO_005 1897 3UTR 100% 13.200 7.920 N Zc3h10 n/a
10 TRCN0000257093 GAGGAGCCAAGTGCAAGTTTC pLKO_005 616 CDS 100% 10.800 6.480 N Zc3h10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09232 pDONR223 100% 88.5% 96.7% None (many diffs) n/a
2 ccsbBroad304_09232 pLX_304 0% 88.5% 96.7% V5 (many diffs) n/a
3 TRCN0000480901 TTTTGTTATTCTTCTGCTATGGAG pLX_317 23.7% 88.5% 96.7% V5 (many diffs) n/a
Download CSV