Transcript: Mouse NM_134007.4

Mus musculus CDGSH iron sulfur domain 1 (Cisd1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Cisd1 (52637)
Length:
965
CDS:
96..422

Additional Resources:

NCBI RefSeq record:
NM_134007.4
NBCI Gene record:
Cisd1 (52637)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134007.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215667 GTCTTAGAATATAGTTGTATC pLKO.1 684 3UTR 100% 10.800 8.640 N Cisd1 n/a
2 TRCN0000190356 CGTAGGACCTCTGATCATCAA pLKO.1 386 CDS 100% 4.950 3.960 N Cisd1 n/a
3 TRCN0000292664 CGTAGGACCTCTGATCATCAA pLKO_005 386 CDS 100% 4.950 3.960 N Cisd1 n/a
4 TRCN0000217545 CCTGCTGATTTACGTAGAATG pLKO.1 463 3UTR 100% 10.800 7.560 N Cisd1 n/a
5 TRCN0000217364 GCAAATCACAGCTCTCATATC pLKO.1 538 3UTR 100% 10.800 7.560 N Cisd1 n/a
6 TRCN0000200970 CCTGGCTTACAAGAAGTTCTA pLKO.1 179 CDS 100% 4.950 3.465 N Cisd1 n/a
7 TRCN0000191883 GCACGTTTGTTGAAAGAAGAA pLKO.1 592 3UTR 100% 4.950 3.465 N Cisd1 n/a
8 TRCN0000193037 GCTAAAGAGAATCGCACCAAA pLKO.1 201 CDS 100% 4.950 3.465 N Cisd1 n/a
9 TRCN0000292734 GCTAAAGAGAATCGCACCAAA pLKO_005 201 CDS 100% 4.950 3.465 N Cisd1 n/a
10 TRCN0000192944 GCTCACATAAAGCACAACGAA pLKO.1 351 CDS 100% 3.000 2.100 N Cisd1 n/a
11 TRCN0000292662 GCTCACATAAAGCACAACGAA pLKO_005 351 CDS 100% 3.000 2.100 N Cisd1 n/a
12 TRCN0000190774 GATCCAGAAAGACAACCCGAA pLKO.1 239 CDS 100% 2.160 1.512 N Cisd1 n/a
13 TRCN0000292665 GATCCAGAAAGACAACCCGAA pLKO_005 239 CDS 100% 2.160 1.512 N Cisd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134007.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03666 pDONR223 100% 81.5% 86.1% None (many diffs) n/a
2 ccsbBroad304_03666 pLX_304 0% 81.5% 86.1% V5 (many diffs) n/a
3 TRCN0000465842 GAGGCAGATTAAAGCATGGCATAC pLX_317 100% 81.5% 86.1% V5 (many diffs) n/a
Download CSV