Transcript: Mouse NM_134020.1

Mus musculus transmembrane p24 trafficking protein 4 (Tmed4), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tmed4 (103694)
Length:
1645
CDS:
5..688

Additional Resources:

NCBI RefSeq record:
NM_134020.1
NBCI Gene record:
Tmed4 (103694)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134020.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112421 CGCTGCTTCATCGAGGAAATA pLKO.1 122 CDS 100% 13.200 18.480 N Tmed4 n/a
2 TRCN0000325916 CGCTGCTTCATCGAGGAAATA pLKO_005 122 CDS 100% 13.200 18.480 N Tmed4 n/a
3 TRCN0000112424 CGGCAACTATCGAACTCAGAT pLKO.1 163 CDS 100% 4.950 6.930 N Tmed4 n/a
4 TRCN0000325848 CGGCAACTATCGAACTCAGAT pLKO_005 163 CDS 100% 4.950 6.930 N Tmed4 n/a
5 TRCN0000112423 GAGCAGGATTATCAGAGGTAT pLKO.1 521 CDS 100% 4.950 6.930 N Tmed4 n/a
6 TRCN0000325915 GAGCAGGATTATCAGAGGTAT pLKO_005 521 CDS 100% 4.950 6.930 N Tmed4 n/a
7 TRCN0000112422 CGAACTCAGATGTGGGACAAA pLKO.1 173 CDS 100% 4.950 3.960 N Tmed4 n/a
8 TRCN0000112420 CCCAAGGTCAAGTCCTTTCTT pLKO.1 942 3UTR 100% 5.625 3.938 N Tmed4 n/a
9 TRCN0000325917 CCCAAGGTCAAGTCCTTTCTT pLKO_005 942 3UTR 100% 5.625 3.938 N Tmed4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134020.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05268 pDONR223 100% 87.1% 94.7% None (many diffs) n/a
2 ccsbBroad304_05268 pLX_304 0% 87.1% 94.7% V5 (many diffs) n/a
3 TRCN0000491679 ACAGCACTAGCAGGAACCTGGACT pLX_317 46% 87.1% 94.7% V5 (many diffs) n/a
Download CSV