Transcript: Mouse NM_134138.1

Mus musculus proteasome (prosome, macropain) assembly chaperone 2 (Psmg2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Psmg2 (107047)
Length:
1059
CDS:
81..875

Additional Resources:

NCBI RefSeq record:
NM_134138.1
NBCI Gene record:
Psmg2 (107047)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193591 GTATCTGCTTACACCTTGTTT pLKO.1 500 CDS 100% 5.625 7.875 N Psmg2 n/a
2 TRCN0000320014 GTATCTGCTTACACCTTGTTT pLKO_005 500 CDS 100% 5.625 7.875 N Psmg2 n/a
3 TRCN0000215720 CATGTGTAAGATTGGTTATTT pLKO.1 200 CDS 100% 15.000 12.000 N Psmg2 n/a
4 TRCN0000216169 CTTGCAATAGATCTGATTATT pLKO.1 168 CDS 100% 15.000 12.000 N Psmg2 n/a
5 TRCN0000216246 CAGATAATCAAACCCTGTAAC pLKO.1 765 CDS 100% 10.800 8.640 N Psmg2 n/a
6 TRCN0000173268 CATTCGTATCACCGCAACGAT pLKO.1 453 CDS 100% 3.000 2.400 N Psmg2 n/a
7 TRCN0000350139 CATTCGTATCACCGCAACGAT pLKO_005 453 CDS 100% 3.000 2.400 N Psmg2 n/a
8 TRCN0000193941 CCAGGATCATTGTTCTCTCAA pLKO.1 427 CDS 100% 4.950 3.465 N Psmg2 n/a
9 TRCN0000173257 CTCATCCTGCTGAGATCACAA pLKO.1 894 3UTR 100% 4.950 3.465 N Psmg2 n/a
10 TRCN0000350140 CTCATCCTGCTGAGATCACAA pLKO_005 894 3UTR 100% 4.950 3.465 N Psmg2 n/a
11 TRCN0000194166 GCTTCAGTTAAGGTCCATCTT pLKO.1 341 CDS 100% 4.950 3.465 N Psmg2 n/a
12 TRCN0000350138 GCTTCAGTTAAGGTCCATCTT pLKO_005 341 CDS 100% 4.950 3.465 N Psmg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08680 pDONR223 100% 84.4% 87.8% None (many diffs) n/a
2 ccsbBroad304_08680 pLX_304 0% 84.4% 87.8% V5 (many diffs) n/a
3 TRCN0000474331 CGCGCAAGGTTAAGCCTCATGTAG pLX_317 45.4% 84.4% 87.8% V5 (many diffs) n/a
Download CSV