Transcript: Human NM_134433.3

Homo sapiens regulatory factor X2 (RFX2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
RFX2 (5990)
Length:
3884
CDS:
117..2213

Additional Resources:

NCBI RefSeq record:
NM_134433.3
NBCI Gene record:
RFX2 (5990)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_134433.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014843 CCACCAAATTAGTGCCTCTTA pLKO.1 2289 3UTR 100% 4.950 3.465 N RFX2 n/a
2 TRCN0000014844 GCTCTCCTTCTGGAACTCTAA pLKO.1 1229 CDS 100% 4.950 3.465 N RFX2 n/a
3 TRCN0000014845 GCTGCTCGACAAAGATGACAT pLKO.1 2084 CDS 100% 4.950 3.465 N RFX2 n/a
4 TRCN0000014847 CCAGTTCCACTACATCGAGAA pLKO.1 1202 CDS 100% 4.050 2.835 N RFX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134433.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06859 pDONR223 100% 96.4% 96.2% None 8A>N;522_523ins75;1754G>A n/a
2 ccsbBroad304_06859 pLX_304 30.2% 96.4% 96.2% V5 8A>N;522_523ins75;1754G>A n/a
3 TRCN0000491438 GGGTTAACCCAGCTTGCTCCGTTC pLX_317 11.3% 96.4% 96.2% V5 8A>N;522_523ins75;1754G>A n/a
Download CSV