Transcript: Human NM_138283.1

Homo sapiens cystatin like 1 (CSTL1), mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
CSTL1 (128817)
Length:
736
CDS:
247..684

Additional Resources:

NCBI RefSeq record:
NM_138283.1
NBCI Gene record:
CSTL1 (128817)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138283.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073627 GCCAGCAACGACACCTACTTA pLKO.1 409 CDS 100% 5.625 3.938 N CSTL1 n/a
2 TRCN0000222600 AGAGTTTAATTTGCGAGTCTT pLKO.1 575 CDS 100% 4.950 3.465 N CSTL1 n/a
3 TRCN0000073623 CTTCATTCAATCCTACAACAA pLKO.1 387 CDS 100% 4.950 3.465 N CSTL1 n/a
4 TRCN0000073625 GAGTTTAATTTGCGAGTCTTT pLKO.1 576 CDS 100% 4.950 3.465 N CSTL1 n/a
5 TRCN0000073624 CATGAATTCAACACTCAACTT pLKO.1 366 CDS 100% 0.000 0.000 N CSTL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138283.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09516 pDONR223 100% 99.7% 99.3% None 262T>C n/a
2 ccsbBroad304_09516 pLX_304 0% 99.7% 99.3% V5 262T>C n/a
3 TRCN0000477297 CGCTATTAATCCAAAAGGAAGCGG pLX_317 63.9% 99.7% 99.3% V5 262T>C n/a
Download CSV