Transcript: Mouse NM_138304.2

Mus musculus calmodulin-like 4 (Calml4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Calml4 (75600)
Length:
861
CDS:
56..517

Additional Resources:

NCBI RefSeq record:
NM_138304.2
NBCI Gene record:
Calml4 (75600)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138304.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104767 CAAGTGAAATATGACACGTTT pLKO.1 461 CDS 100% 4.950 6.930 N Calml4 n/a
2 TRCN0000104766 CCAAGTGAAATATGACACGTT pLKO.1 460 CDS 100% 2.640 3.696 N Calml4 n/a
3 TRCN0000348642 AGTGAAATATGACACGTTTAT pLKO_005 463 CDS 100% 13.200 9.240 N Calml4 n/a
4 TRCN0000348641 TTCCTGTGCGAGACTACTAAG pLKO_005 498 CDS 100% 10.800 7.560 N Calml4 n/a
5 TRCN0000104768 GCAGACTCATGGGATAGACAA pLKO.1 214 CDS 100% 4.950 3.465 N Calml4 n/a
6 TRCN0000104769 CTCACTCACAAGGAAGTGGAT pLKO.1 404 CDS 100% 2.640 1.848 N Calml4 n/a
7 TRCN0000335536 CTCACTCACAAGGAAGTGGAT pLKO_005 404 CDS 100% 2.640 1.848 N Calml4 n/a
8 TRCN0000104765 GCCAAGATCAAGAGAGCAGAT pLKO.1 522 3UTR 100% 4.050 2.430 N Calml4 n/a
9 TRCN0000335537 GCCAAGATCAAGAGAGCAGAT pLKO_005 522 3UTR 100% 4.050 2.430 N Calml4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138304.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12970 pDONR223 100% 66.6% 67.9% None (many diffs) n/a
2 ccsbBroad304_12970 pLX_304 0% 66.6% 67.9% V5 (many diffs) n/a
3 TRCN0000466757 GGTTTTCACAATCCACCCCTAGAG pLX_317 100% 66.6% 67.9% V5 (many diffs) n/a
Download CSV