Transcript: Mouse NM_138583.2

Mus musculus transport and golgi organization 2 (Tango2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tango2 (27883)
Length:
1529
CDS:
77..907

Additional Resources:

NCBI RefSeq record:
NM_138583.2
NBCI Gene record:
Tango2 (27883)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138583.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184283 GCCACCTGTATAACGGCTTTA pLKO.1 414 CDS 100% 10.800 15.120 N Tango2 n/a
2 TRCN0000184160 CCTGAGCCTATTGTCTTGACA pLKO.1 503 CDS 100% 3.000 4.200 N Tango2 n/a
3 TRCN0000183029 CCTGTATTTGTTTGTGTTCAT pLKO.1 1271 3UTR 100% 4.950 3.465 N Tango2 n/a
4 TRCN0000195871 CCAATGGAGAACGACAGAGTT pLKO.1 1061 3UTR 100% 4.950 2.970 N Tango2 n/a
5 TRCN0000149426 CTACCTGAAGAAGGTCTCTAT pLKO.1 388 CDS 100% 4.950 3.465 N TANGO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138583.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09518 pDONR223 100% 84.4% 86.9% None (many diffs) n/a
2 ccsbBroad304_09518 pLX_304 0% 84.4% 86.9% V5 (many diffs) n/a
3 TRCN0000468437 GCGTGCATTCACTTTCTGTTACAG pLX_317 48.1% 84.4% 86.9% V5 (many diffs) n/a
Download CSV