Transcript: Mouse NM_138595.2

Mus musculus glycine decarboxylase (Gldc), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Gldc (104174)
Length:
3792
CDS:
182..3259

Additional Resources:

NCBI RefSeq record:
NM_138595.2
NBCI Gene record:
Gldc (104174)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138595.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120389 CCACAGAAATCGCCATTCTAA pLKO.1 2682 CDS 100% 5.625 3.938 N Gldc n/a
2 TRCN0000120391 GCCACAGAAATCGCCATTCTA pLKO.1 2681 CDS 100% 5.625 3.938 N Gldc n/a
3 TRCN0000120390 GCTGGAGAGTTTACTCAACTA pLKO.1 712 CDS 100% 4.950 3.465 N Gldc n/a
4 TRCN0000120387 CCAGGGCAAATGTTTACATTT pLKO.1 3632 3UTR 100% 1.320 0.924 N Gldc n/a
5 TRCN0000303305 ATATTGGCATGGGCTATTATA pLKO_005 594 CDS 100% 15.000 10.500 N GLDC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138595.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06282 pDONR223 100% 86.4% 92% None (many diffs) n/a
2 ccsbBroad304_06282 pLX_304 0% 86.4% 92% V5 (many diffs) n/a
3 TRCN0000475831 AGCTGTTTTCGAAGCGAGCATGCA pLX_317 11.8% 86.4% 92% V5 (many diffs) n/a
Download CSV