Transcript: Mouse NM_138599.5

Mus musculus translocase of outer mitochondrial membrane 70 homolog A (yeast) (Tomm70a), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tomm70a (28185)
Length:
3778
CDS:
149..1984

Additional Resources:

NCBI RefSeq record:
NM_138599.5
NBCI Gene record:
Tomm70a (28185)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138599.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000319639 ACCTGTTAAAGGGATATTAAA pLKO_005 2203 3UTR 100% 15.000 10.500 N Tomm70a n/a
2 TRCN0000319641 AGCAAAGAAATACGGATTAAA pLKO_005 1948 CDS 100% 15.000 10.500 N Tomm70a n/a
3 TRCN0000350077 CCTATGAACTCAGACGTTTAT pLKO_005 1349 CDS 100% 13.200 9.240 N Tomm70a n/a
4 TRCN0000077166 CTGTTGAACTTAATCCCAAAT pLKO.1 693 CDS 100% 10.800 7.560 N Tomm70a n/a
5 TRCN0000317697 CTGTTGAACTTAATCCCAAAT pLKO_005 693 CDS 100% 10.800 7.560 N Tomm70a n/a
6 TRCN0000077163 CCTCTGATTCTGTAGAACTTT pLKO.1 2524 3UTR 100% 5.625 3.938 N Tomm70a n/a
7 TRCN0000077164 GCCCAGGCATTAACAGATCAA pLKO.1 1604 CDS 100% 4.950 3.465 N Tomm70a n/a
8 TRCN0000317755 GCCCAGGCATTAACAGATCAA pLKO_005 1604 CDS 100% 4.950 3.465 N Tomm70a n/a
9 TRCN0000077167 GCCTGACTTAGATAAGGTCAT pLKO.1 1204 CDS 100% 4.050 2.835 N Tomm70a n/a
10 TRCN0000077165 GCTGTTGAACTTAATCCCAAA pLKO.1 692 CDS 100% 4.050 2.835 N Tomm70a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138599.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14031 pDONR223 100% 88.7% 91.9% None (many diffs) n/a
2 ccsbBroad304_14031 pLX_304 0% 88.7% 91.9% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000474057 ATAATTTGGATTAACGGATTACTT pLX_317 23.4% 88.7% 91.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV