Transcript: Mouse NM_138649.1

Mus musculus synaptotagmin XVII (Syt17), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Syt17 (110058)
Length:
1623
CDS:
205..1617

Additional Resources:

NCBI RefSeq record:
NM_138649.1
NBCI Gene record:
Syt17 (110058)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138649.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176266 CATCATTCTTACGAGGCACAA pLKO.1 1322 CDS 100% 4.050 5.670 N Syt17 n/a
2 TRCN0000243888 TCATTCTTACGAGGCACAATT pLKO_005 1324 CDS 100% 13.200 10.560 N Syt17 n/a
3 TRCN0000243887 AGCTGCTGCTTTCTCTAAATT pLKO_005 1163 CDS 100% 15.000 10.500 N Syt17 n/a
4 TRCN0000243889 ATGACTACTTCCGGAAGTTTG pLKO_005 644 CDS 100% 10.800 7.560 N Syt17 n/a
5 TRCN0000243886 TACAGCCTGACTCGGAGAATC pLKO_005 499 CDS 100% 10.800 7.560 N Syt17 n/a
6 TRCN0000175795 GATGACTACTTCCGGAAGTTT pLKO.1 643 CDS 100% 5.625 3.938 N Syt17 n/a
7 TRCN0000194348 CGATGACTACTTCCGGAAGTT pLKO.1 642 CDS 100% 4.950 3.465 N Syt17 n/a
8 TRCN0000173230 CTGCACTTCAGCACACAGTAT pLKO.1 754 CDS 100% 4.950 3.465 N Syt17 n/a
9 TRCN0000175696 GACTCCAATCTTGATGACGTA pLKO.1 685 CDS 100% 2.640 1.848 N Syt17 n/a
10 TRCN0000243885 GACTGAACGTGGACATCATTC pLKO_005 1202 CDS 100% 10.800 6.480 N Syt17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138649.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08345 pDONR223 100% 87.4% 95.1% None (many diffs) n/a
2 ccsbBroad304_08345 pLX_304 0% 87.4% 95.1% V5 (many diffs) n/a
3 TRCN0000472364 CAGGTTCCACTTTATGCTGCGGAG pLX_317 30.2% 87.4% 95.1% V5 (many diffs) n/a
4 TRCN0000487926 GCTTCGGCTGTTCTTATACGTTGG pLX_317 18.3% 87.4% 95.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV