Transcript: Mouse NM_138682.2

Mus musculus leucine rich repeat containing 4 (Lrrc4), mRNA.

Source:
NCBI, updated 2017-04-16
Taxon:
Mus musculus (mouse)
Gene:
Lrrc4 (192198)
Length:
3636
CDS:
134..2092

Additional Resources:

NCBI RefSeq record:
NM_138682.2
NBCI Gene record:
Lrrc4 (192198)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106470 CGGGAGTATATCCCAACCAAT pLKO.1 1076 CDS 100% 4.950 6.930 N Lrrc4 n/a
2 TRCN0000106471 CCACAATACATGACCATATTA pLKO.1 1926 CDS 100% 15.000 12.000 N Lrrc4 n/a
3 TRCN0000159532 CCACTATCTCTGAACCTTATA pLKO.1 2025 CDS 100% 13.200 10.560 N LRRC4 n/a
4 TRCN0000158689 GCTGATTCATTAGGGATTATT pLKO.1 3175 3UTR 100% 15.000 10.500 N LRRC4 n/a
5 TRCN0000106472 CCACAATAACCTCTCATCTTT pLKO.1 952 CDS 100% 5.625 3.938 N Lrrc4 n/a
6 TRCN0000106474 CCCACAATAACCTCTCATCTT pLKO.1 951 CDS 100% 4.950 3.465 N Lrrc4 n/a
7 TRCN0000161850 GCTTTCACATTGCACCAGATT pLKO.1 2814 3UTR 100% 4.950 3.465 N LRRC4 n/a
8 TRCN0000106473 CGGTATCTCAACCTCATGGAA pLKO.1 362 CDS 100% 3.000 2.100 N Lrrc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03923 pDONR223 100% 92.8% 97.7% None (many diffs) n/a
2 ccsbBroad304_03923 pLX_304 0% 92.8% 97.7% V5 (many diffs) n/a
3 TRCN0000469626 ACAGCAATTCGCGGCATTTTCGAA pLX_317 20.9% 92.8% 97.7% V5 (many diffs) n/a
Download CSV